The Expression of Toll-like receptors in eutopic and ectopic endometrium and its implication in the inflammatory pathogenesis of adenomyosis

Ethics statement. The study was approved by the Institutional Review Board of the Y angpu Hospital, Tongji University School of Medicine, Shanghai, China. All biopsy specimens were collected according to the guidelines of the Declaration of Helsinki. Written informed consent was obtained from all subjects participating in the study. Participants. From September 10, 2015 to November 12, 2016, 30 patients who underwent laparoscopic surgery due to adenomyosis at the Gynecological Department of Y angpu Hospital, Tongji University School of Medicine were included in this study. The diagnosis was confirmed by histology. Healthy women who underwent intrauterine device (IUD) placement were recruited as control group (n = 30). All patients enrolled in this study were in the proliferative stage. Participants with regular menstrual cycles (28–32 days), were not administered any hormonal therapy including oral contraceptive pills, progestins, gonadotropin-releasing hormone agonist, or levonorgestrel intrauterine system (LNG-IUS) in recent 3 months. Individuals with cancer, cardiovascular diseases, autoimmune diseases, endocrine diseases, metabolic diseases, pelvic inflammatory disease, and other infectious diseases were excluded. Tissue collection. EU and EC samples were derived from adenomyosis patients, and endometrium samples without adenomyosis (CE) were derived from healthy controls under strict asepsis. All the fresh tissue specimens were frozen on liquid nitrogen and stored at −80 °C for RNA and protein extraction. RNA extraction and real-time PCR. Total RNA was extracted from the frozen tissue samples using Trizol reagent (Invitrogen, Waltham, MA, USA). Complementary DNA was synthesized by reverse transcriptase (Fermentas, Waltham, MA, USA) at 42 °C for 1 h and 75 °C for 5 min. Primers specific for TLR1-9, IL-6, and IL-8 are shown in Table 1. Real-time PCR was performed with SYBR-Green Master Mix on an ABI7300 platform and Name Sequences (5′-3′) Annealing temperature (°C) Product size (bp) TLR1 F: AGGGTCAGCTGGACTTCAGA 60 215 R: AAAATCCAAATGCAGGAACG TLR2 F: ATTGTGCCCATTGCTCTTTC 60 311 R: CTGCCCTTGCAGATACCATT TLR3 F: TTGCCTTGTATCTACTTTTGGGG 61 157 R: TCAACACTGTTATGTTTGTGGGT TLR4 F: CCGCTTTCACTTCCTCTCAC 60 167 R: CATCCTGGCATCATCCTCAC TLR5 F: GAGCCCCTACAAGGGAAAAC 61 184 R: TGCTGATGGCATTGCTAAAG TLR6 F: GGATAGCCACTGCAACATCA 60 175 R: CAGCGGTAGGTCTTTTGGAA TLR7 F: AATGTCACAGCCGTCCCTAC 61 185 R: TTATTTTTACACGGCGCACA TLR8 F: TCCTTCAGTCGTCAATGCTG 61 167 R: CGTTTGGGGAACTTCCTGTA TLR9 F: AAAGAGGAAGGGGTGAAGGA 60 211 R: GACAGCAGCTACAGGGAAGG IL-6 F: AGCCACTCACCTCTTCAGAAC 60 118 R: GCCTCTTTGCTGCTTTCACAC IL-8 F: CAAGAGCCAGGAAGAAAC 60 227 R: TGGTCCACTCTCAATCAC β-actin F: CAAGATCATTGCTCCTCCTG 60 90 R: ATCCACATCTGCTGGAAGG Table 1. Primers for real-time RT-PCR. Note: RT-PCR, real time-polymerase chain reaction; TLR, Toll-like receptor; IL, interleukins. www.nature.com/scientificreports/ 3 ScIeNTIfIc REpoRTs | 7: 7365 | DOI:10.1038/s41598-017-07859-5 related software (Thermo Fisher Scientific, Waltham, MA, USA). β-actin was used as an internal control. The PCR cycling conditions were as follows: 94 °C for 7 min, followed by 40 cycles of 15 s at 94 °C and 60 °C for 45 s. Δ Ct was defined as the difference in the cycle threshold between the target gene and internal control, and ΔΔCt was defined as the difference between the Δ Ct values of the test sample and control. The relative expression of the target genes was calculated as 2−ΔΔCt . Western blot analysis. Protein was extracted with radio-immunoprecipitation assay(RIPA) buffer contain- ing a protease inhibitor cocktail and centrifuged at 12,000 × g for 15 min at 4 °C. The supernatant protein was quantified by bicinchoninic acid assay (BCA, Thermo Fisher Scientific, Rockford, USA) and stored at − 80 °C. Total lysates were resolved in SDS-PAGE. Proteins were blotted onto a nitrocellulose membrane and incu- bated at 4 °C overnight with one of the following primary antibodies: anti-TLR1 (1:500, ab180798), anti-TLR2 (1:100, ab16894), anti-TLR3 (1:1000, ab62566), anti-TLR4 (1:500, ab13556), anti-TLR5 (1:1000, ab62460), anti-TLR7 (1:1000, ab45371), anti-TLR8 (1:1000, ab53630), anti-TLR9 (1:800, ab12121) (Abcam, Cambridge, MA, USA), anti-TLR6 (1:1000, av31755, Sigma-Aldrich Corporation, St. Louis, MO, USA), GAPDH (1:2000, 5174, CST, Danvers, MA, USA), diluted in TBS containing 1% skimmed milk. The blots were then washed with TBS, incubated with the corresponding secondary antibodies (HRP-labeled Goat Anti-Rabbit IgG (H+ L), a0181; HRP-labeled Donkey Anti- Goat IgG (H+L), a0181; HRP-labeled Goat Anti-Mouse IgG (H+L), a0216) (Beyotime Institute of Biotechnology, Haimen, China) at room temperature for 1 h. The optical density method of protein signal strength was performed by using the enhanced chemiluminescence western blotting system (BioRad, Richmond, CA), and GAPDH served as an internal standard to determine the protein level. Statistical analysis. All statistical analyses were performed with SPSS version 16.0 for Windows (SPSS Inc.,Chicago, IL, USA). The normality test of the measurement data is conducted by using the kurtosis and skew- ness coefficients and the Shapiro-Wilks test. Normally distributed data were presented as means ± standard devi- ations, and intragroup differences were investigated using analysis of variance (ANOV A) or Student t test when necessary. Non-normally distributed data were presented as median (quartiles), and intragroup differences were made using Kruskal-Wallis or Mann-Whitney test when necessary. Categorical variables were expressed as the number of cases and percentages (%). Correlations of variables for each group were determined using Pearson correlation coefficient (r) or Spearman rank correlation coefficient (r s) when necessary, and Bonforoni correction was used to determine the P value for significance(P < 0.00139). A value of P ≤ 0.05 (2-sided test) was considered statistically significant. Statistics diagrams were performed with GraphPad Prism 5.

General data of patients in the adenomyosis and non-adenomyosis groups. The 30 adenomy- osis patients included 3 nulliparas and 27 multiparas who ranged in age from 32 to 52 years with a mean of 42.48 ± 5.28 years and a mean body mass index (BMI) of 23.28 ± 2.71 (18.73–28.89) kg/m 2. The 30 non-adeno- myosis subjects were all multiparas who ranged in age from 25 to 47 years with a mean of 38.69 ± 9.12 years and a mean BMI of 22.24 ± 3.31 (18.41–28.31) kg/m2. There were no statistically significant differences in age, BMI, fertility, or history of prior surgery between the groups (P > 0.05 each). Clinical characteristics of the adenomyosis group. The mean history of the patients with adenomyosis was 13.54 ± 5.13 (1–240) months. According to the visual analog scale (V AS) system 15, there were 6 (20.00%) cases of minimal dysmenorrhea, 9 (30.00%) cases of moderate dysmenorrhea, and 15 (50.00%) cases of severe dysmenorrhea. According to the pictorial blood loss assessment chart (PBAC) 15, there were 17 (56.67%) cases of normal menstrual capacity and 13 (43.33%) cases of menorrhagia. The mean uterine volume of adenomyosis group was 225.16 ± 101.83 (82.33–522.64) cm 3. Expression of IL-6, IL-8 and TLRs mRNAs in CE, EU and EC. RT-PCR analysis showed that the mRNAs expression of IL-6 and IL-8 in EC and EU was significantly higher than that in CE, and their expression in EC was significantly higher than that in EU (P < 0.01). The mRNAs expression of TLR1-6, 8 and 9 in EC and EU was significantly higher than that in CE (P < 0.01), and their expression (except TLR6) in EC was significantly higher than that in EU (P < 0.01). And there was no significant difference in TLR7 expression between EU vs. CE, EC vs. CE, EU vs. EC (Fig. 1). Expression of TLRs protein in CE, EU and EC. Western blot analysis was performed to detect the expres- sion of TLRs in CE, EU and EC. The protein expression of TLR1-6, 8 and 9 in EC and EU was significantly higher than that in CE, and their expression (except TLR6) in EC was significantly higher than that in EU (P < 0.05 or P < 0.01). And there was no significant difference in TLR7 expression between EU vs. CE, EC vs. CE, EU vs. EC (Fig. 2). Correlations between the mRNA expressions of IL-6 and TLRs in adenomyosis. There was a significant positive correlation between the mRNA expressions of IL-6 and TLR1-4, 5 and 9 in EU (P < 0.00139), and the mRNA expression of IL-6 was positively correlated with that of TLR1, 2, 4, 5, 6 and 9 in EC (P < 0.00139), while it showed no significant correlation with the other TLRs. The value of r or rs are presented in Table 2 (Fig. 3). Correlations between the mRNAs expression of IL-8 and TLRs in adenomyosis. Data analysis revealed that there was a significant positive correlation between the mRNA expression of IL-8 and TLR1, 2, 4, 5 and 9 in EU (P < 0.00139), and the mRNA expression of IL-8 was positively correlated with that of TLR1, 2, 4, 5, 6, 8 and 9 in EC (P < 0.00139), while it showed no significant correlation with the other TLRs. The value of r or r s are shown in Table 2 (Fig. 3). www.nature.com/scientificreports/ 4 ScIeNTIfIc REpoRTs | 7: 7365 | DOI:10.1038/s41598-017-07859-5 Figure 1. mRNAs expression of IL-6, IL-8 and TLRs in CE, EU and EC. CE: endometrium without adenomyosis; EU: eutopic endometrium with adenomyosis; EC: ectopic endometrium with adenomyosis; NS P > 0.05; *P < 0.05; **P 0.05; *P < 0.05; **P < 0.01. www.nature.com/scientificreports/ 5 ScIeNTIfIc REpoRTs | 7: 7365 | DOI:10.1038/s41598-017-07859-5

Adenomyosis is a benign invasion of the endometrium into the myometrium that is closely related to endome- triosis. As a type of chronic inflammatory disease, the inflammatory pathogenesis of adenomyosis involved in abnormal immune responses and genital tract infections have attracted increasing attention 10, 16. As indispensable members of pattern recognition receptors (PRRs), TLRs play a major role in endometrial defense against microor- ganisms. TLRs have also been described as transmembrane proteins that recognize specific pathogen-associated molecular patterns (PAMPs) found in viruses and other invading pathogens. In addition to PAMPs, TLRs recog- nize damage-associated molecular patterns (DAMP), which are proteins or nucleic acids released during necrosis 17. PAMPs and endogenous DAMPs bind to TLRs and activate the downstream signaling pathways leading to acti- vation of inflammatory pathways in the endometrium, where they may play a vital role in the inflammatory pathogenesis of adenomyosis. Recent evidence has revealed that the adenomyosis tissues are infiltrated with inflammatory immune cells and various inflammatory cytokines 4, 5. Among others, IL-6 and IL-8 have been studied extensively and the most commonly used to demonstrate the inflammatory pathological state of adenomyosis18. Luo et al.12 found that the expression of TLR4 in EU was higher than that in the normal endometrium, and was the highest in EC tissue. TLR4 activation stimulated IL-8 secretion, thus enhancing the invasion and proliferation of endometrial stro - mal cells through the FAK signal pathway, and these effects could be abolished by an anti-CXCL8 neutralizing antibody or by a FAK inhibitor. It was found in this study that the mRNA expression of IL-6 and IL-8 in EU was significantly higher than that in CE, and was the highest in EC (P < 0.01), which is consistent with previous stud- ies, indicating that adenomyosis is an inflammatory pathological state. Furthermore, we tested the mRNA and protein expressions of TLRs in EC, EU and CE and found that the expression of TLRs were higher in EU, with the expression of TLR1-6, 8 and 9 in EU were significantly higher than that in CE, and were the highest in EC (except TLR6). In addition, we analyzed the correlation between IL-6 and IL-8 and TLRs in adenomyosis patients and found that TLRs were positively correlated with corresponding IL-6 and IL-8 in EU and EC, of which TLR1, 2, 4, 5 and 9 were significantly positively correlated with IL-6 and IL-8. We therefore conclude that amplification of TLRs in the inflammatory immune signaling system may result in an inflammatory pathological state of adeno- myosis. TLRs can regulate cell proliferation and survival, and create a tumor microenvironment that can facilitate tumor growth by expanding immune cells and integrating inflammatory responses and tissue repair processes 11. Additionally, we previously found that LPS/TLR4-mediated stromal cells of adenomyosis acquired an invasive phenotype14. From the results herein, these same roles in tumor microenvironment further demonstrated that TLRs were involved in the inflammatory pathogenesis of adenomyosis and may be mediated via NK-κB signaling pathway. The exact pathogenesis of adenomyosis has not yet been fully elucidated. In the recent years, some few domes- tic studies proposed a novel concept of ‘determinant of uterine eutopic endometrium’ for endometriosis. The author suggested that endometriosis onset or not depends on the biological characteristics of eutopic endo- metrium, and retrograde menstruation was just a bridge to achieve this process from potential contribution to pathogenesis 19. In this study, the mRNA expression of IL-6 and IL-8 in both EC and EU was significantly higher than that in CE, indicating that EU was also in an inflammatory state. We further tested the mRNA and protein expressions of TLRs and found that TLRs in both EC and EU were significantly higher than those in CE, and the trend of the relative expression of TLRs in EU was consistent with that in EC, suggesting that the biological char- acteristics of EU were similar to those of EC, and different from those of CE; the abnormal immune response of EU led to EU activation, which is consistent with the molecular mechanism of this hypothesis. The relationship between the expression of IL-6 and IL-8 and TLRs in EU and the pathogenesis of adenomyosis require more future research. In addition, patients were divided into several subgroups according to the clinical characteristics in this study. After statistical analysis confirmed that: The gene expression of TLRS (TLRS = TLR1 + TLR2 + TLR3 + TLR4 + TLR5 + TLR6 + TLR7 + TLR8 + TLR9) in severe and moderate dysmenorrhea group was significantly higher than that in minimal dysmenorrhea group in EU and EC (P < 0.05 or P < 0.01). And the gene expression of TLRS in menorrhagia group were significantly higher than that in normal group in EU and EC (P < 0.05 or P < 0.01). The correlations between the expression of TLRs and the disease severity suggest that rises in dysmenorrhea and menstrual capacity paralleled increase in the expression of TLRs. Based on the results obtained from our previous and present studies and literature review, we speculate the following possible pathogenesis of adenomyosis: TLR4-dependent signaling activated by endogenous PAMPs and DAMPs promotes the secretion of different proinflammatory cytokines and chemokines, stimulates endometrial cell proliferation, recruits and activates immune cells (macrophages, DCs, NK cells), triggers local inflammatory response, and activates the fabrication and maintenance of an inflammatory microenvironment by the specific TLR1 TLR2 TLR3 TLR4 TLR5 TLR6 TLR7 TLR8 TLR9 EU IL-6 0.828*** 0.777*** 0.557*** 0.758*** 0.881*** NS 0.497** NS 0.852*** IL-8 0.844*** 0.776*** 0.551** 0.625*** 0.844*** NS 0.538** NS 0.820*** EC IL-6 0.792*** 0.770*** NS 0.748*** 0.726*** 0.611*** NS 0.535** 0.666*** IL-8 0.818*** 0.805*** NS 0.700*** 0.749*** 0.677*** NS 0.723*** 0.602*** Table 2. Correlations between the mRNAs expression of IL-6 and IL-8 and TLRs in EU and EC. Note: EU: eutopic endometrium with adenomyosis; EC: ectopic endometrium with adenomyosis. NS P > 0.05; *P < 0.05; **P < 0.01; ***P < 0.00139. www.nature.com/scientificreports/ 6 ScIeNTIfIc REpoRTs | 7: 7365 | DOI:10.1038/s41598-017-07859-5 immune system, which further induce stromal cell proliferation and invasion, promote the development and progression of the local inflammatory pathology of adenomyosis, and eventually lead to the development of adenomyosis. Despite our important findings, there are some limitations in this study. First, we did not detect the perito- neal fluid and serous expression of IL-6, IL-8 and TLRs. In addition, the menstrual dates used in this study were obtained only by review of the medical records without histologic confirmation. Therefore, further studies with larger sample sizes are needed to avoid these limitations and verify the findings of the present study. In summary, adenomyosis is a common and intractable gynaecological disease mostly affecting women of reproductive age. In this study, the expression of IL-6, IL-8 and TLRs showed an increased tendency in CE, EU and EC, and the expression of TLRs in EU and EC was positively correlated with the expression of IL-6 and IL-8. These findings may provide a theory basis for further revealing the development and progression of the inflam- matory pathology, and the underlying immune inflammatory pathogenesis of adenomyosis. Future studies in cell or animal models are required to address the role of TLRs signaling pathways in the inflammatory pathogenesis and the molecular mechanisms of adenomyosis. Data availability. All data is available within manuscript.

1. Struble, J., Reid, S. & Bedaiwy, M. A. Adenomyosis: A Clinical Review of a Challenging Gynecologic Condition. J Minim Invasive Gynecol 23, 164–185 (2016). 2. Carrarelli, P . et al. Expression of Inflammatory and Neurogenic Mediators in Adenomyosis: A Pathogenetic Role. Reprod Sci (2016). 3. Scheerer, C. et al. Characterization of endometriosis-associated immune cell infiltrates (EMaICI). Arch Gynecol Obstet 294, 657–664 (2016). 4. Khan, K. N. et al. Additive effects of inflammation and stress reaction on Toll-like receptor 4-mediated growth of endometriotic stromal cells. Hum Reprod 28, 2794–2803 (2013). 5. Banu, S. K., Lee, J. Jr., Speights, V . O., Starzinski-Powitz, A. & Arosh, J. A. Cyclooxygnemase-2 regulates survival, migration, and invasion of human endometriotic cells through multiple mechanisms. Endocrinology 149, 1180–1189 (2008). 6. Khan, K. N., Kitajima, M., Fujishita, A., Nakashima, M. & Masuzaki, H. Toll-like receptor system and endometriosis. J Obstet Gynaecol Re 39, 1281–1292 (2013). Figure 3. Correlations between the mRNAs expression of IL-6, IL-8 and TLRs in adenomyosis. CE: endometrium without adenomyosis; EU: eutopic endometrium with adenomyosis; EC: ectopic endometrium with adenomyosis. NS P > 0.05; *P < 0.05; **P < 0.01; ***P < 0.00139. www.nature.com/scientificreports/ 7 ScIeNTIfIc REpoRTs | 7: 7365 | DOI:10.1038/s41598-017-07859-5 7. Lin, W ., Chang, C. Y ., Hsu, Y ., Chiang, J. & Wan, L. Increased Risk of Endometriosis in Patients With Lower Genital Tract Infection. Medicine 95, e2773 (2016). 8. Khan, K. N. et al. Molecular detection of intrauterine microbial colonization in women with endometriosis. Eur J Obstet Gyn R B 199, 69–75 (2016). 9. Bhatelia, K., Singh, K. & Singh, R. TLRs: Linking inflammation and breast cancer. Cell Signal 26, 2350–2357 (2014). 10. Noreen, M. & Arshad, M. Association of TLR1, TLR2, TLR4, TLR6, and TIRAP polymorphisms with disease susceptibility. Immunol RES 62, 234–252 (2015). 11. Husseinzadeh, N. & Davenport, S. M. Role of Toll-like receptors in cervical, endometrial and ovarian cancers: A review. Gynecol Oncol 135, 359–363 (2014). 12. Luo, X., Zhou, W ., Tao, Y ., Wang, X. & Li, D. TLR4 Activation Promotes the Secretion of IL-8 Which Enhances the Invasion and Proliferation of Endometrial Stromal Cells in an Autocrine Manner via the FAK Signal Pathway. Am J Reprod Immunol 74, 467–479 (2015). 13. Y eo, S. G. et al. Vol. 10, 1199–1208 (2013). 14. Guo, J. et al. LPS/TLR4-mediated stromal cells acquire an invasive phenotype and are implicated in the pathogenesis of adenomyosis. Sci Rep 6, 21416 (2016). 15. Liu, M., Cheng, Z., Dai, H., Qu, X. & Kang, L. Long-term efficacy and quality of life associated with laparoscopic bilateral uterine artery occlusion plus partial resection of symptomatic adenomyosis. Eur J Obstet Gyn R B 176, 20–24 (2014). 16. Khan, K. N. et al. Intra-uterine microbial colonization and occurrence of endometritis in women with endometriosis. Hum Reprod 29, 2446–2456 (2014). 17. Cannova, J., Breslin, S. J. P . & Zhang, J. Toll-like receptor signaling in hematopoietic homeostasis and the pathogenesis of hematologic diseases. Frontiers of Medicine 9, 288–303 (2015). 18. Aboussahoud, W . et al. Expression and function of Toll-like receptors in human endometrial epithelial cell lines. J Reprod Immunol 84, 41–51 (2010). 19. J., L. Guideline for the diagnosis and treatment of endometriosis. Zhonghua Fu Chan Ke Za Zhi 50, 161–169 (2015).

We thank all of the patients and families who participated in this study. This work was supported by a grant from the Science and Technology Commission of Shanghai Municipality (grant number 14411972100). Author Contributions All authors contributed to patient management and writing of the report. J.G., L.C. and N.L. conceived and designed the experiments; C.J. performed the experiments and wrote the main manuscript text; X.Q., W .Y . and Q.R. contributed to statistical analysis and revision of the manuscript; C.L. participated in sample collection; Z.C. guided the manuscript. All authors reviewed the manuscript. Written consent to publish was obtained. Additional Information Supplementary information accompanies this paper at doi:10.1038/s41598-017-07859-5 Competing Interests: The authors declare that they have no competing interests. Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre- ative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not per- mitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. © The Author(s) 2017