Association of Wnt4 (rs121908652) and Bmp15 (rs104894766) polymorphisms with endometriosis risk in Iranian women

Association of Wnt4 (rs121908652) and Bmp15 (rs104894766) polymorphisms with endometriosis risk in Iranian women | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Help Center Sign In Submit a Preprint Cite Share Download PDF Article Association of Wnt4 (rs121908652) and Bmp15 (rs104894766) polymorphisms with endometriosis risk in Iranian women Shima Rezaei Afarjami, Seyed Mehrdad Kassaee This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-11064757/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Endometriosis is a multifactorial and polygenic disorder with a strong genetic aspect in endometrium characterized by the presence of endometrial tissue outside the uterine cavity. This disorder is associated with pelvic pain and infertility in women. The present work aimed at investigating the association between the risk of endometriosis in Iranian women and the polymorphisms in BMP15 rs104894766 and WNT4 rs121908652 . In the present case-control study, the variants were investigated in 100 patient women with endometriosis and 100 healthy subjects (both groups aged 20–35 years old) using PCR-RFLP methods. Statistical analysis was performed with SPSS software using the χ² test and calculation of the odds ratios (OR) at 95% confidence intervals. There was significant association between the risk of endometriosis and the Wnt4 rs12190865 polymorphism ( p = 0.02, OR = 0.5) at genotypic and allele levels. No significant association was observed between endometriosis and the BMP15 rs104894766 polymorphism ( p = 0.2, OR = 0.72). The polymorphisms in the Wnt4 gene might be related to the pathogenesis of endometriosis in infertile adult women. Health sciences/Diseases Health sciences/Endocrinology Biological sciences/Genetics Health sciences/Medical research Health sciences/Risk factors Endometriosis single nucleotide polymorphism BMP15 gene WNT4 gene infertile women Iranian population Figures Figure 1 Introduction Endometriosis is a common gynecologic disease, affecting almost 10% of women in reproductive age 1 . It is defined by the presence of endometrial glands and stroma outside the uterus 2 . The tissue may frequently develop on the ovarian surface, behind the uterus, in the pelvic cavity, on the intestinal wall, and in other sites including the peritoneum, the uterosacral ligaments, the fallopian tubes, the uterine surface, and the rectovaginal septum. Less frequently, lesions may involve cesarean-section or surgical scars, the bladder, the diaphragm, and more distant sites such as the brain or extremities 3 . The ovary is the most frequent site of endometriosis, and both ovaries are involved in approximately 50% of cases 4 . Endometriosis is classified into four stages—minimal, mild, moderate, and severe—reflecting the location and severity of the lesions. Symptoms may depend on the location of active endometriosis, although this is not always the case; the most common manifestations are pelvic pain and infertility 5 , 6 . The disorder can occur at any age from puberty to menopause but is most frequently observed between 20 and 40 years old 7 , typically during the reproductive cycles 7 . The symptoms are often exacerbated with the menstrual cycle 7 because the ectopic endometriotic tissue exhibits a comparable hormonal changes and responses to those of intrauterine endometrial cells. The normal endometrium lining the uterus responds to cyclic changes in female hormones. The overall prevalence of endometriosis is not precisely known and varies according to geographic location and ethnicity 3 . Prevalence is estimated at approximately 10–30% in infertile women and lower in fertile women 7 . Endometriosis is a common finding in infertile women because the site of the disease depends on the route of endometrial-tissue transfer, and because retrograde menstruation is the most common mechanism 8 . Endometriosis was recognized as a multifactorial and polygenic disorder with a strong genetic component 9 . The role of immediate relatives was one of the first genetic factors confirmed by extensive investigations 10 . Women whose mothers or sisters have endometriosis have a 6- to 9-fold higher risk of developing the disease 10 . The disease is commonly observed in both monozygotic and dizygotic twins and begins at similar ages in non-twin affected sisters. Prevalence among immediate relatives of affected women is 6- to 7-fold higher than the general population 11 . These observations indicate that endometriosis has a genetic basis and that susceptibility is inherited as a complex genetic trait. Several genes were recognized to play a role in the development of endometriosis 10 . Identification of the genes and chromosomal regions involved in endometriosis is therefore of great importance for understanding its pathophysiology, identifying individuals at risk, and enabling appropriate treatment. The previous research works has shown a significant relationship between genes involved with fertility and endometriosis 6 . Many infertile women may have endometriosis, yet the underlying cause is often not readily apparent; the relationship between infertility and endometriosis remains incompletely understood. It is possible that endometriotic lesions secrete factors that are detrimental to gametes or embryos. Endometriosis may cause miscarriage in women and may affect fertility either directly or through secondary mechanisms. Infertility associated with endometriosis is therefore of considerable clinical importance 8 . Among the genes involved in cellular and physiological processes in fertility, the Wnt and Bmp gene families are particularly important 12 . The Wnt4 has a clear impact on fertility in both genders, especially in females. The literature data indicate a wide range of studies regarding the association of Wnt4 gene family with fertility and mechanisms of ovulation worldwide. These investigations demonstrate the association of polymorphisms and similar mutations with fertility 13 , 14 . The role of Wnt gene family, particularly Wnt4 , in regulating and evolving the reproductive system and cellular mechanisms of ovulation were well established 15 , 16 . Bone morphogenetic proteins (BMPs) are secreted signaling molecules belonging to the transforming growth factor-β (TGF-β) superfamily. More than 30 members of this family had been identified till now 17 . These growth-factor molecules act primarily at epithelial–mesenchymal sites and in interactions between them. When their expression was examined by mutation or genetic alteration, a wide range of functions in the development of the skeletal, nervous, and hematopoietic systems was revealed 18 . The BMP signals act on non-hematopoietic cells and promote cell survival. The BMPs regulate the development and function of tissues 19 and play regulatory roles in various cellular processes, including proliferation, differentiation, and apoptosis 20 . The BMP15 gene is located on the X chromosome and comprises two exons separated by a 4.5-kb intron. Its complete transcript is a 1179-nucleotide sequence encoding a 393-amino-acid prepro-peptide; the mature peptide is 125 amino acids long. Examination of mutations in this gene has shown that even a single amino-acid substitution can exert marked effects and that the smallest change can significantly influence ovulation rate 21 . Given the importance of the Wnt4 and BMP15 genes in tissue formation and embryonic survival, it is critical to find the association of the polymorphism in the Wnt4 rs121908652 and BMP15 rs104894766 with susceptibility to endometriosis. The polymorphisms on these genes have been studied in different parts of the world, and it was shown that the overall prevalence of endometriosis depends on geographical location and race as well 22 . To the best of our knowledge, this is the first report on the association of two genetic variants on endometriosis in Iranian women. Considering the genetic diversity of the Iranian population and the specificity of the polymorphisms of each race, it is important to investigate the endometriosis polymorphisms in this population. Previously, there were investigations on the association between endometriosis and healthy diet 23 as well as between genetic mutations and infertility among Iranian women 24 . The identification of genetic variants as diagnostic and predictive factors for managing reproductive and childbirth healthcare is essential and should be conducted in Iran. Therefore, this research work aimed at investigating the frequency of polymorphisms in the BMP15 and Wnt4 genes and their association with the risk of endometriosis in Iranian women. Materials and Methods Patient population and study design This case-control study was conducted on 100 women with a history of endometriosis of unknown etiology who attended the gynecology center of Tehran Women Hospital, Iran, who had no hormonal, anatomical, or genetic disorders (case group), and on 100 fertile healthy women with at least one child and no signs or symptoms of miscarriage or endometriosis (control group). The patient and control groups were selected from the same ethnic area. The screening process involved initial evaluation by a gynecologist, diagnosis and confirmation of the diseases, data collection through a research questionnaire and in-person interviews. Due to the novelty of the examination of the targeted polymorphisms, the allele frequency was not known in the Iranian population. The participants of both groups were nearly age matched. Materials The chemicals including isopropanol, ethanol, KCl, EDTA, boric acid, and MgCl 2 were bought from Merck (Darmstadt Germany) in analytical reagent grade. The Tris hydrochloride was purchased from Sigma-Aldrich (Darmstadt, Germany) in molecular biology grade. The double distilled water purchased from Ghatran Shimi (Tehran, Iran). Genotyping After obtaining informed consent from both patient and healthy subjects, 5 mL of blood was collected into EDTA-containing tubes. DNA was extracted using a commercial kit (GenID, Strasberg, Germany) according to the instructions of the manufacturer. The samples from each participant were diluted with water to reach the DNA concentration of 50 ng/µL for further molecular assays. To this end, the optical density (OD) of the specimens were read using a NanoDrop Microvolume Spectrophotometer (Thermo Fisher Scientific Inc., Singapore). The DNA hydration solution of each participant (50 µL) was then kept at -20 ˚C. The DNA samples were stored at − 20°C until use. Genotyping was performed by polymerase chain reaction–restriction-fragment-length polymorphism (PCR-RFLP). The PCR reaction mixture (final volume 25 µL) contained 2 µL of each forward and reverse primer, 3 µL of extracted DNA, 12.5 µL of master mix (GenID, Germany), and sterile distilled water to volume. PCR amplification of the target gene was carried out with primers designed using Gene Runner software. Primers were designed according to a Primer Blast program at NCBI and checked by Gene Runner software. The primer sequences of BMP15 were: Forward: 5′-AACTGGTCCTTTTCATGGAACACA-3′; Reverse: 5′-ATATTCCTCGGTTTGGTCTGAGAG-3′. The sequence of primers for Wnt4 was 5´- GTCAGTGGGGAGCATCTCAG − 3´as forward primer, and 5´-CACACCTGCCGAAGAGATGG − 3´ as reverse primer. Amplification was performed on a thermocycler (Eppendorf, Germany) under the following conditions for the genes. Wnt4 1 cycle denaturation at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 40 s, annealing at 60°C for 45 s, and extension at 72°C for 40 s, and finally one cycle of final extension at 72°C for 5 min BMP15 initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 45 s, annealing at 60°C for 45 s, and extension at 72°C for 40 s; followed by a final extension at 72°C for 5 min. The PCR products were verified by electrophoresis on a 3% agarose gel at 120V for 45 min. For WNT4 , the solution for each patient consisting of 2 µL buffer, 2 µL restriction enzyme ( Hpy188III ), 10 µL PCR product, and 18 µL distilled water were gently mixed in a 1.5 mL microtube. The solutions were then incubated at 37°C for 24 h. The digested solution by the enzymes were then analyzed by gel electrophoresis on 3%GelRedstained agarose gel. We used Horizontal Electrophoresis Cell with TBE Buffer (pH = 8.3), ladder were used 50bp DNA Ladder (Thermo) after electrophoresis, the amplified PCR products were perceived under UV light. For BMP15 , the amplified products were then digested with the restriction enzyme MspI (Fermentas, Germany), selected with NEBcutter software. The RFLP reaction contained 10 µL of PCR product, 2 U of MspI , 2 µL of buffer, and water to a final volume of 32 µL. the samples were incubated at 37°C for 16 h. The restriction patterns were examined by electrophoresis on a 3% agarose gel. Ethics statement The research was conducted in accordance with the WMA Declaration of Helsinki (as revised in October 2024). The study protocol was approved by the ethics committee of the Tehran Women Hospital, Iran. Informed consent was obtained from all participants prior to their inclusion in the study. Statistical analysis Data were analyzed with SPSS software version 18 (SPSS Inc., Chicago, IL, USA). Genotype and allele frequencies were calculated in the patient and control groups. The allele and genotype frequencies between groups was compared by the χ² test. The association between the studied polymorphisms and endometriosis was evaluated by calculating odds ratio (OR) and 95% confidence intervals (CI) between the study and control groups. A p -value < 0.05 was considered statistically significant. Results General characteristics In this work, we measure two key characteristics of the participants including the age and body mass index (BMI), as detailed in Table 1 . The participants were young adult women of 20 to 35 years old. The mean age of both groups was approximately the same 29 years old. The individuals were chosen from nearly similar body mass index, ~ 26 kg m − 2 . There is no significant difference between the mean age of two case and control groups, p value = 0.279. Similarly, we found no significant difference between the BMI of two groups, p value = 0.167 (Table 1 ). Table 1 General characteristics of two case and control groups Characteristic Case Control p -value Age (year) 28.76 ± 6.18 29.83 ± 7.88 0.279 BMI (Kg m − 2 ) 25.63 ± 6.24 26.68 ± 4.72 0.167 The BMI stands for body mass index BMP15 Genotyping The electrophoretic pattern of the PCR products of the BMP15 gene on the 3% agarose gel shows three distinct genotypes (Fig. 1 a). The genotypes are C/C (homozygous major allele) – a single 342-bp fragment; C/T (heterozygous) – three fragments of 342, 187 and 160 bp; T/T (homozygous minor allele) – two fragments of 160 and 187 bp. Genotype and allele frequencies of the rs104894766 polymorphism were presented in Table 2 . Accordingly, the association between the genotypes of this polymorphism and the risk of endometriosis can be determined. The CT genotype showed no significant association with endometriosis ( p = 0.2, OR = 0.72, 95% CI 0.39–1.32). Comparison of the allele frequencies between the control and patient groups likewise indicated that the T allele was only slightly associated with the risk of endometriosis ( p = 0.06, OR = 0.66, 95% CI 0.42–1.03). Table 2 Genotype and allele frequency distribution of the BMP15 rs104894766 polymorphism in patient and control groups Genotype Case n (%) Control n (%) OR (% 95 CI) p value CC 51 61 1 (Reference) - CT 35 30 0.72 (0.39–1.32) 0.2 TT 14 8 0.48 (0.19–1.23) 0.12 Allele C 137 152 1 (Reference) - T 63 46 0.66 (0.2–1.03) 0.06 The CI and OR stand for condifence interval and the odds ratio, respectively WNT4 Genotyping Regarding the PCR products of the WNT4 genes on a 3% agarose gel (Fig. 1 b), there exist one fragment of 368 base pairs for G/G dominant homozygous, three fragments of 368, 208, and 160 base pairs for G/A heterozygous, and two fragments of 208 and 160 base pairs for A/A recessive homozygous. In lane 2, three bands of 368, 208, and 160 base pairs were observed which means the genotype of this individual for WNT4 ( rs121908652 ) is G/A heterozygous. In lane 3, only one band of 368 base pairs was observed which means the genotype of this individual for WNT4 ( rs121908652 ) is G/G dominant homozygous. In lane 4, two bands of 160 and 208 base pairs were observed which means the genotype of this individual for WNT4 ( rs121908652 ) is A/A recessive homozygous. The genotypes of patients and controls for the WNT4 rs121908652 polymorphism consisted of 48 cases of G/G homozygous dominant, 43 cases of G/A heterozygous, and 9 cases of A/A homozygous recessive (Table 3 ); while the genotype of the control group for the WNT4 gene polymorphism includes 65 cases of G/G homozygous dominant, 29 cases of G/A heterozygous, and 6 cases of A/A homozygous recessive. The statistical analysis of the results indicates a significant relationship between the WNT4 rs121908652 polymorphism and endometriosis at a p < 0.05 (Table 3 ). Table 3 Genotype and allele frequency distribution of the WNT4 rs121908652 polymorphisms in control and patient groups Genotype WNT4 Case n (%) Control n (%) OR (% 95 CI) P value GG 48 65 1 (Reference) - GA 43 29 0.5 (0.27–0.91) 0.02 * AA 9 6 0.49 (0.16–1.48) 0.19 Allele G 139 159 1 (Reference) - A 61 41 0.59 (0.37–0.93) 0.02 * The CI and OR stand for condifence interval and the odds ratio, respectively; the p values with asterisk ( * ) shows the statistical significant differences. Discussion Endometriosis and infertility are both multifactorial and polygenic diseases. Several genetic variants have been examined in relation to endometriosis, and their polymorphisms have been studied in different populations worldwide. Given the genetic background of the Iranian population and the population-specific nature of many polymorphisms, investigation of endometriosis-related polymorphisms in Iranian population is important for future research worldwide. There were significant research and advancements in the diagnosis and treatment of infertility and endometriosis, with approximately 65% of infertile couples achieving parenthood using new methods and available technologies 2 . Genetic variants also play a pivotal role in female fertility, influencing cellular and physiological processes essential for fertility, particularly within the WNT-BMP gene family 21 . Different reports suggest this gene family is truly involved in development of several developmental processes such as anterior-posterior axis and oocytes development in the female reproductive and therefore fertility 25 . For example, members of the BMP family, particularly BMP15 , acts a growth factor for oocyte derivatives by regulating proliferation and granulosa cell differentiation 21 . It was reported that mutations in BMP -family genes cause infertility in females 21 . The heterozygote mutation in the BMP15 gene was diagnosed as infertile women due to ovarian hypergonadotropic failure 26 . The Bmp15 polymorphism has a profound impact on oocyte maturation in females 27 . Also, the Bmp15 mRNA expression levels were associated with endometriosis in patients 26 . In the present study, no significant association was observed between endometriosis and the Bmp15 rs104894766 polymorphism in Iranian women. Consistently, the previous studies only reported association between BMP15 gene polymorphism and diminished ovarian reserve 28 and reduced ovarian response 29 , without any direct relationship with endometriosis in patients. In the present work, there was a significant association between the WNT4 (rs121908652) polymorphism and endometriosis in Iranian women. The mentioned polymorphism frequencies had an extensive increase in patients and controls. Both groups were of nearly the same age groups and body mass indexes. These characteristics were found to influence endometriosis so that the lower BMI was discussed to be related to the risk factor 30 . Accordingly, we conducted the study within the young adult groups of nearly the same body weight to address any concerns regarding the impact of these traits on the results of the present investigation. In the present study, the GG genotype frequency of WNT4 (rs121908652) was 48% and 65%, the GA genotype was 43% and 29% and the AA genotype was 9% and 6%, with p value of 0.02, suggesting that this polymorphism is related with endometriosis. In Brazilian population, the association between four single nucleotide polymorphisms (SNPs) in WNT4 gene family was studied, and only the rs16826658 and rs3820282 polymorphisms were associated with endometriosis 6 . In Chinese Han women, there was an association between Wnt4 ( rs2235529 ) polymorphism and endometriosis risk, while no significant association was found between endometriosis risk and three other SNPs ( rs7521902, rs16826658 , and rs7515106 ) 31 . In a Greek population, the SNP rs7521902 in the WNT4 gene was found significantly associated with endometriosis patients at genotypic level 32 . Accordingly, not all polymorphisms can be related to endometriosis. The genetic background of each specific population is unique and different from other populations. Additionally, it is also well known that the ultimate role of a gene or genetic variant in a particular disease is determined by its interaction with environmental factors and other genes. Thus, it is expected to observe different results due to environmental factors that has roots in societal and cultural differences as well as the level of societal advancement and the predominant lifestyle within a population 23 . The present findings in Iranian population can be insightful for our understanding of etiology of endometriosis and early diagnosis. Conclusion This study found a correlation between the clinical and genetic findings with endometriosis risk in adult Iranian women. The WNT4 rs121908652 polymorphism is associated with endometriosis. There was no signific relationship between the BMP15 rs104894766 polymorphism and endometriosis in Iranian women at the genotypic level. The WNT4 rs121908652 polymorphism may be a genetic risk factor for endometriosis in adult women. Declarations Authors Contribution SRA and SMK contributed to the conceptualization, methodology, data validation, formal analysis, and visualization. SRA conducted investigation, data curation, and writing original draft. SMK prepared resources, review and editing, supervision, and project administration. Both authors have read the final manuscript and agreed to be submitted for publication. Acknowledgement The authors acknowledge the support of Islamic Azad University for providing the research facilities to accomplish this work. Proof reading and editing services by Hamyarapply Group (Tehran-Iran) is greatly appreciated. Funding This work has received no specific funding under a special grant number. Declaration Statement The authors declare no conflict of interest. Informed Consent Statement All the participants were informed about the tests and also further publication of the results. Then the informed consent was obtained from all the subjects engaged with the study. Data Availability The data generated or analyzed during this study are included in this article, the supplementary information, and the dbSNP repository with the following web links: https://www.ncbi.nlm.nih.gov/snp/?term=rs121908652 https://www.ncbi.nlm.nih.gov/snp/?term=rs104894766 References Lyu, S. et al. Identification of candidate microRNA biomarkers of endometriosis in different bodily fluids. Sci. Rep. 16 , 6218 (2026). Parasar, P., Ozcan, P. & Terry, K. L. Endometriosis: epidemiology, diagnosis and clinical management. Curr. Obstet. Gynecol. Rep. 6 , 34–41 (2017). Agarwal, N. & Subramanian, A. Endometriosis - Morphology, clinical presentations and molecular pathology. J. Lab. Physicians . 2 , 1–9 (2020). Horne, A. W. & Missmer, S. A. Pathophysiology, diagnosis, and management of endometriosis. BMJ 379 , e070750 (2022). Ballard, K., Lane, H., Hudelist, G., Banerjee, S. & Wright, J. Can specific pain symptoms help in the diagnosis of endometriosis? A cohort study of women with chronic pelvic pain. Fertil. Steril. 94 , 20–27 (2010). Mafra, F., Catto, M., Bianco, B., Barbosa, C. P. & Christofolini, D. Association of WNT4 polymorphisms with endometriosis in infertile patients. J. Assist. Reprod. Genet. 32 , 1359–1364 (2015). Haas, D. et al. Endometriosis: a premenopausal disease? Age pattern in 42,079 patients with endometriosis. Arch. Gynecol. Obstet. 286 , 667–670 (2012). Elizur, S. E., Mostafa, J., Berkowitz, E. & Orvieto, R. Endometriosis and infertility: pathophysiology, treatment strategies, and reproductive outcomes. Arch. Gynecol. Obstet. 312 , 1037–1048 (2025). Treloar, S. A. et al. Genomewide linkage study in 1,176 affected sister pair families identifies a significant susceptibility locus for endometriosis on chromosome 10q26. AJHG 77, 365–376 (2005). Bischoff, F. Z. & Simpson, J. L. Heritability and molecular genetic studies of endometriosis. Hum. Reprod. Update . 6 , 37–44 (2000). Viganò, P., Parazzini, F., Somigliana, E. & Vercellini, P. Endometriosis: epidemiology and aetiological factors. Best Pract. Res. Clin. Obstet. Gynecol. 18 , 177–200 (2004). Wang, S., Huang, G., Hu, Q. & Zou, Q. A network-based method for the identification of putative genes related to infertility Biochimica et Biophysica Acta-General Subjects 1860, 2716–2724 (2016). Zhang, Q. et al. Roles and action mechanisms of WNT4 in cell differentiation and human diseases: A review. Cell. Death Discovery . 7 , 287 (2021). Gajbhiye, R., Fung, J. N. & Montgomery, G. W. Complex genetics of female fertility. NPJ Genomic Med. 3 , 29 (2018). Vainio, S., Heikkila, M., Kispert, A., Chin, N. & McMahon A. P. Female development in mammals is regulated by Wnt-4 signalling Nature 397, 405–409 (1999). Jordan, B. K. et al. Up-regulation of Wnt-4 signalling and dosage-senstitive sex reversal in humans. Am. J. Hum. Genet. 68 , 1102–1109 (2001). Detmer, K. & Walker, A. N. Bone morphogenetic proteins act synergistically with haematopoietic cytokines in the differentiation of haematopoietic progenitors. Cytokine 17 , 36–42 (2002). Ducy, P. & Karsenty, G. The family of bone morphogenetic proteins. Kidney Int. 57 , 2207–2214 (2000). Walters, M. J. et al. Calmodulin-dependent protein kinase IV mediated antagonism of BMP signaling regulates lineage and survival of hematopoietic progenitors. Development 129 , 1455–1466 (2002). Alarmo, E. L., Kuukasjärvi, T., Karhu, R. & Kallioniemi, A. A comprehensive expression survey of bone morphogenetic proteins in breast cancer highlights the importance of BMP4 and BMP7. Breast Cancer Res. Treat. 103 , 239–246 (2006). Galloway, S. M. et al. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nat. Genet. 25 , 279–283 (2000). Bougie, O., Nwosu, I. & Warshafsky, C. Revisiting the impact of race/ethnicity in endometriosis Reproduction Fertility 3 , 34–41 (2022). Noormohammadi, M. et al. Mediterranean diet adherence and healthy diet indicator might decrease odds of endometriosis. Sci. Rep. 15 , 36750 (2025). Hojati, V. The role of gene polymorphisms in infertility, polyendocrine metabolic ovarian syndrome and recurrent miscarriage in the Iranian women population: A review study. Int. J. Reproductive Biomed. 24 , 585–604 (2026). Boyer, A. et al. WNT4 is required for normal ovarian follicle development and female fertility. FASEB J. 24 , 3010–3025 (2010). Wiweko, B. et al. BMP15 mRNA profile in granulosa cells from endometriosis patients undergoing in vitro fertilization. J. Phys. 1073 , 032052 (2018). Ledig, S., Röpke, A., Haeusler, G., Hinney, B. & Wieacker, P. BMP15 mutations in XX gonadal dysgenesis and premature ovarian failure. Am. J. Obstet. Gynecol. 198 , 84e81–84e85 (2008). Ghasemifar, S. et al. Association of P73, BMP15, and GDF9 gene polymorphisms with diminished ovarian reserve. Biomedical Res. Therapy . 11 , 6941–6949 (2024). Meireles, A. J. C. et al. Association of FSHR, LH, LHR, BMP15, GDF9, AMH, and AMHR polymorphisms with poor ovarian response in patients undergoing in vitro fertilization. JBRA Assist. Reprod. 25 , 439–446 (2021). Rowlands, I. J., Hockey, R., Abbott, J. A., Montgomery, G. W. & Mishra, G. D. Body mass index and the diagnosis of endometriosis: Findings from a national data linkage cohort study. Obes. Res. Clin. Pract. 16 , 235–241 (2022). Wu, Z. et al. Analysis of WNT4 polymorphism in Chinese Han women with endometriosis. Reprod. Biomed. Online . 30 , 415–420 (2015). Matalliotakis, M. et al. The role of gene polymorphisms in endometriosis. Mol. Med. Rep. 16 , 5881–5886 (2017). Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformation.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 11 Oct, 2026 Reviewers agreed at journal 10 Oct, 2026 Reviewers invited by journal 09 Oct, 2026 Editor assigned by journal 07 Oct, 2026 Editor invited by journal 28 Sep, 2026 Submission checks completed at journal 24 Sep, 2026 First submitted to journal 23 Sep, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-11064757","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":738926685,"identity":"eef87918-111c-425f-be0c-2555829a2393","order_by":0,"name":"Shima Rezaei Afarjami","email":"","orcid":"","institution":"Islamic Azad University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shima","middleName":"Rezaei","lastName":"Afarjami","suffix":""},{"id":738926686,"identity":"264f445a-1919-4642-bce6-a50601043ed8","order_by":1,"name":"Seyed Mehrdad Kassaee","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+ElEQVRIiWNgGAWjYBACgwMQWo6NmbHxQQIDQwKYm4BHi2EDhDbmZ29uNiBKizGUTpzZc7xNgoBiCDBjP/74w48KG8YNNxLbKh7UHM5jYD/8gOHhHtxabHhyzCR7zqQxGwC13Eg4driYgSfNgCHhGR4tDDlsDLxth9kgWtgOJzYw5ACddwCPw/ifP/74999/HpCWgoR/QC38b/BrMZZIMJDmbTggIdlzsI0hsQ2oRYKALYYz3phJyxxLNuBnb2yWSOxLT2yTeGZwAJ8Wg/Ppjz++qbGrb2Nmf/jxxzfrxH7+5IcPf+DRggnYgJgkDaNgFIyCUTAKMAEAvpdZWSeNdkwAAAAASUVORK5CYII=","orcid":"","institution":"Islamic Azad University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Seyed","middleName":"Mehrdad","lastName":"Kassaee","suffix":""}],"badges":[],"createdAt":"2026-09-16 16:23:47","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-11064757/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-11064757/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":123712219,"identity":"a6ce5744-7b08-4419-a89d-a060034d7142","added_by":"auto","created_at":"2026-10-23 01:11:36","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":251671,"visible":true,"origin":"","legend":"\u003cp\u003eResults of RFLP analysis of two gene polymorphisms. (a) the \u003cem\u003eBMP15\u003c/em\u003e (\u003cem\u003ers104894766\u003c/em\u003e) polymorphism; Lane 1: 50-bp molecular-weight marker; Lane 2: C/T heterozygote; Lane 3: T/T homozygous minor allele; Lane 4: C/C homozygous major allele. (b) the \u003cem\u003eWNT4\u003c/em\u003e (\u003cem\u003ers121908652\u003c/em\u003e) polymorphism; Lane 1: 50-bp molecular-weight marker; Lane 2: G/A heterozygous allele; Lane 3: G/G dominant homozygous allele; Lane 4: A/A recessive homozygous allele\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-11064757/v1/9e5267b7cda505983bbfdd13.jpeg"},{"id":123742060,"identity":"e0fac082-a4d7-4798-939c-d549c45fc162","added_by":"auto","created_at":"2026-10-23 08:17:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":616522,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-11064757/v1/b31efa6a-8e85-48c7-af5b-2162d62e7213.pdf"},{"id":123712218,"identity":"b9e8c4f9-478a-4f8d-8106-7368ae0efb8a","added_by":"auto","created_at":"2026-10-23 01:11:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":188874,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-11064757/v1/42dec97f638773ce428fe520.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Association of Wnt4 (rs121908652) and Bmp15 (rs104894766) polymorphisms with endometriosis risk in Iranian women","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEndometriosis is a common gynecologic disease, affecting almost 10% of women in reproductive age \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. It is defined by the presence of endometrial glands and stroma outside the uterus \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. The tissue may frequently develop on the ovarian surface, behind the uterus, in the pelvic cavity, on the intestinal wall, and in other sites including the peritoneum, the uterosacral ligaments, the fallopian tubes, the uterine surface, and the rectovaginal septum. Less frequently, lesions may involve cesarean-section or surgical scars, the bladder, the diaphragm, and more distant sites such as the brain or extremities \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. The ovary is the most frequent site of endometriosis, and both ovaries are involved in approximately 50% of cases \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eEndometriosis is classified into four stages\u0026mdash;minimal, mild, moderate, and severe\u0026mdash;reflecting the location and severity of the lesions. Symptoms may depend on the location of active endometriosis, although this is not always the case; the most common manifestations are pelvic pain and infertility \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. The disorder can occur at any age from puberty to menopause but is most frequently observed between 20 and 40 years old \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e, typically during the reproductive cycles \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. The symptoms are often exacerbated with the menstrual cycle \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e because the ectopic endometriotic tissue exhibits a comparable hormonal changes and responses to those of intrauterine endometrial cells. The normal endometrium lining the uterus responds to cyclic changes in female hormones.\u003c/p\u003e \u003cp\u003eThe overall prevalence of endometriosis is not precisely known and varies according to geographic location and ethnicity \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Prevalence is estimated at approximately 10\u0026ndash;30% in infertile women and lower in fertile women \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Endometriosis is a common finding in infertile women because the site of the disease depends on the route of endometrial-tissue transfer, and because retrograde menstruation is the most common mechanism \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eEndometriosis was recognized as a multifactorial and polygenic disorder with a strong genetic component \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. The role of immediate relatives was one of the first genetic factors confirmed by extensive investigations \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Women whose mothers or sisters have endometriosis have a 6- to 9-fold higher risk of developing the disease \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. The disease is commonly observed in both monozygotic and dizygotic twins and begins at similar ages in non-twin affected sisters. Prevalence among immediate relatives of affected women is 6- to 7-fold higher than the general population \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. These observations indicate that endometriosis has a genetic basis and that susceptibility is inherited as a complex genetic trait. Several genes were recognized to play a role in the development of endometriosis \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIdentification of the genes and chromosomal regions involved in endometriosis is therefore of great importance for understanding its pathophysiology, identifying individuals at risk, and enabling appropriate treatment. The previous research works has shown a significant relationship between genes involved with fertility and endometriosis \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Many infertile women may have endometriosis, yet the underlying cause is often not readily apparent; the relationship between infertility and endometriosis remains incompletely understood. It is possible that endometriotic lesions secrete factors that are detrimental to gametes or embryos. Endometriosis may cause miscarriage in women and may affect fertility either directly or through secondary mechanisms. Infertility associated with endometriosis is therefore of considerable clinical importance \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Among the genes involved in cellular and physiological processes in fertility, the \u003cem\u003eWnt\u003c/em\u003e and \u003cem\u003eBmp\u003c/em\u003e gene families are particularly important \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. The \u003cem\u003eWnt4\u003c/em\u003e has a clear impact on fertility in both genders, especially in females. The literature data indicate a wide range of studies regarding the association of \u003cem\u003eWnt4\u003c/em\u003e gene family with fertility and mechanisms of ovulation worldwide. These investigations demonstrate the association of polymorphisms and similar mutations with fertility \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. The role of \u003cem\u003eWnt\u003c/em\u003e gene family, particularly \u003cem\u003eWnt4\u003c/em\u003e, in regulating and evolving the reproductive system and cellular mechanisms of ovulation were well established \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eBone morphogenetic proteins (BMPs) are secreted signaling molecules belonging to the transforming growth factor-β (TGF-β) superfamily. More than 30 members of this family had been identified till now \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. These growth-factor molecules act primarily at epithelial\u0026ndash;mesenchymal sites and in interactions between them. When their expression was examined by mutation or genetic alteration, a wide range of functions in the development of the skeletal, nervous, and hematopoietic systems was revealed \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. The BMP signals act on non-hematopoietic cells and promote cell survival. The BMPs regulate the development and function of tissues \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e and play regulatory roles in various cellular processes, including proliferation, differentiation, and apoptosis \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. The \u003cem\u003eBMP15\u003c/em\u003e gene is located on the X chromosome and comprises two exons separated by a 4.5-kb intron. Its complete transcript is a 1179-nucleotide sequence encoding a 393-amino-acid prepro-peptide; the mature peptide is 125 amino acids long. Examination of mutations in this gene has shown that even a single amino-acid substitution can exert marked effects and that the smallest change can significantly influence ovulation rate \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eGiven the importance of the \u003cem\u003eWnt4\u003c/em\u003e and \u003cem\u003eBMP15\u003c/em\u003e genes in tissue formation and embryonic survival, it is critical to find the association of the polymorphism in the \u003cem\u003eWnt4 rs121908652\u003c/em\u003e and \u003cem\u003eBMP15 rs104894766\u003c/em\u003e with susceptibility to endometriosis. The polymorphisms on these genes have been studied in different parts of the world, and it was shown that the overall prevalence of endometriosis depends on geographical location and race as well \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. To the best of our knowledge, this is the first report on the association of two genetic variants on endometriosis in Iranian women. Considering the genetic diversity of the Iranian population and the specificity of the polymorphisms of each race, it is important to investigate the endometriosis polymorphisms in this population. Previously, there were investigations on the association between endometriosis and healthy diet \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e as well as between genetic mutations and infertility among Iranian women \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. The identification of genetic variants as diagnostic and predictive factors for managing reproductive and childbirth healthcare is essential and should be conducted in Iran. Therefore, this research work aimed at investigating the frequency of polymorphisms in the \u003cem\u003eBMP15\u003c/em\u003e and \u003cem\u003eWnt4\u003c/em\u003e genes and their association with the risk of endometriosis in Iranian women.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePatient population and study design\u003c/h2\u003e \u003cp\u003eThis case-control study was conducted on 100 women with a history of endometriosis of unknown etiology who attended the gynecology center of Tehran Women Hospital, Iran, who had no hormonal, anatomical, or genetic disorders (case group), and on 100 fertile healthy women with at least one child and no signs or symptoms of miscarriage or endometriosis (control group).\u003c/p\u003e \u003cp\u003eThe patient and control groups were selected from the same ethnic area. The screening process involved initial evaluation by a gynecologist, diagnosis and confirmation of the diseases, data collection through a research questionnaire and in-person interviews. Due to the novelty of the examination of the targeted polymorphisms, the allele frequency was not known in the Iranian population. The participants of both groups were nearly age matched.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMaterials\u003c/h3\u003e\n\u003cp\u003eThe chemicals including isopropanol, ethanol, KCl, EDTA, boric acid, and MgCl\u003csub\u003e2\u003c/sub\u003e were bought from Merck (Darmstadt Germany) in analytical reagent grade. The Tris hydrochloride was purchased from Sigma-Aldrich (Darmstadt, Germany) in molecular biology grade. The double distilled water purchased from Ghatran Shimi (Tehran, Iran).\u003c/p\u003e\n\u003ch3\u003eGenotyping\u003c/h3\u003e\n\u003cp\u003eAfter obtaining informed consent from both patient and healthy subjects, 5 mL of blood was collected into EDTA-containing tubes. DNA was extracted using a commercial kit (GenID, Strasberg, Germany) according to the instructions of the manufacturer. The samples from each participant were diluted with water to reach the DNA concentration of 50 ng/\u0026micro;L for further molecular assays. To this end, the optical density (OD) of the specimens were read using a NanoDrop Microvolume Spectrophotometer (Thermo Fisher Scientific Inc., Singapore). The DNA hydration solution of each participant (50 \u0026micro;L) was then kept at -20 ˚C. The DNA samples were stored at \u0026minus;\u0026thinsp;20\u0026deg;C until use.\u003c/p\u003e \u003cp\u003eGenotyping was performed by polymerase chain reaction\u0026ndash;restriction-fragment-length polymorphism (PCR-RFLP). The PCR reaction mixture (final volume 25 \u0026micro;L) contained 2 \u0026micro;L of each forward and reverse primer, 3 \u0026micro;L of extracted DNA, 12.5 \u0026micro;L of master mix (GenID, Germany), and sterile distilled water to volume. PCR amplification of the target gene was carried out with primers designed using Gene Runner software. Primers were designed according to a Primer Blast program at NCBI and checked by Gene Runner software.\u003c/p\u003e \u003cp\u003eThe primer sequences of \u003cem\u003eBMP15\u003c/em\u003e were: Forward: 5\u0026prime;-AACTGGTCCTTTTCATGGAACACA-3\u0026prime;; Reverse: 5\u0026prime;-ATATTCCTCGGTTTGGTCTGAGAG-3\u0026prime;. The sequence of primers for \u003cem\u003eWnt4\u003c/em\u003e was 5\u0026acute;- GTCAGTGGGGAGCATCTCAG\u0026thinsp;\u0026minus;\u0026thinsp;3\u0026acute;as forward primer, and 5\u0026acute;-CACACCTGCCGAAGAGATGG\u0026thinsp;\u0026minus;\u0026thinsp;3\u0026acute; as reverse primer.\u003c/p\u003e \u003cp\u003eAmplification was performed on a thermocycler (Eppendorf, Germany) under the following conditions for the genes.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eWnt4\u003c/strong\u003e \u003cp\u003e1 cycle denaturation at 94\u0026deg;C for 5 min, followed by 35 cycles of denaturation at 94\u0026deg;C for 40 s, annealing at 60\u0026deg;C for 45 s, and extension at 72\u0026deg;C for 40 s, and finally one cycle of final extension at 72\u0026deg;C for 5 min\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eBMP15\u003c/strong\u003e \u003cp\u003einitial denaturation at 94\u0026deg;C for 5 min; 35 cycles of denaturation at 94\u0026deg;C for 45 s, annealing at 60\u0026deg;C for 45 s, and extension at 72\u0026deg;C for 40 s; followed by a final extension at 72\u0026deg;C for 5 min.\u003c/p\u003e \u003c/p\u003e \u003cp\u003eThe PCR products were verified by electrophoresis on a 3% agarose gel at 120V for 45 min. For \u003cem\u003eWNT4\u003c/em\u003e, the solution for each patient consisting of 2 \u0026micro;L buffer, 2 \u0026micro;L restriction enzyme (\u003cem\u003eHpy188III\u003c/em\u003e), 10 \u0026micro;L PCR product, and 18 \u0026micro;L distilled water were gently mixed in a 1.5 mL microtube. The solutions were then incubated at 37\u0026deg;C for 24 h. The digested solution by the enzymes were then analyzed by gel electrophoresis on 3%GelRedstained agarose gel. We used Horizontal Electrophoresis Cell with TBE Buffer (pH\u0026thinsp;=\u0026thinsp;8.3), ladder were used 50bp DNA Ladder (Thermo) after electrophoresis, the amplified PCR products were perceived under UV light. For \u003cem\u003eBMP15\u003c/em\u003e, the amplified products were then digested with the restriction enzyme \u003cem\u003eMspI\u003c/em\u003e (Fermentas, Germany), selected with NEBcutter software. The RFLP reaction contained 10 \u0026micro;L of PCR product, 2 U of \u003cem\u003eMspI\u003c/em\u003e, 2 \u0026micro;L of buffer, and water to a final volume of 32 \u0026micro;L. the samples were incubated at 37\u0026deg;C for 16 h. The restriction patterns were examined by electrophoresis on a 3% agarose gel.\u003c/p\u003e\n\u003ch3\u003eEthics statement\u003c/h3\u003e\n\u003cp\u003e The research was conducted in accordance with the WMA Declaration of Helsinki (as revised in October 2024). The study protocol was approved by the ethics committee of the Tehran Women Hospital, Iran. Informed consent was obtained from all participants prior to their inclusion in the study.\u003c/p\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData were analyzed with SPSS software version 18 (SPSS Inc., Chicago, IL, USA). Genotype and allele frequencies were calculated in the patient and control groups. The allele and genotype frequencies between groups was compared by the χ\u0026sup2; test. The association between the studied polymorphisms and endometriosis was evaluated by calculating odds ratio (OR) and 95% confidence intervals (CI) between the study and control groups. A \u003cem\u003ep\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eGeneral characteristics\u003c/h2\u003e \u003cp\u003eIn this work, we measure two key characteristics of the participants including the age and body mass index (BMI), as detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The participants were young adult women of 20 to 35 years old. The mean age of both groups was approximately the same 29 years old. The individuals were chosen from nearly similar body mass index, ~ 26 kg m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e. There is no significant difference between the mean age of two case and control groups, \u003cem\u003ep\u003c/em\u003e value\u0026thinsp;=\u0026thinsp;0.279. Similarly, we found no significant difference between the BMI of two groups, \u003cem\u003ep\u003c/em\u003e value\u0026thinsp;=\u0026thinsp;0.167 (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGeneral characteristics of two case and control groups\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCharacteristic\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCase\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge (year)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e28.76\u0026thinsp;\u0026plusmn;\u0026thinsp;6.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e29.83\u0026thinsp;\u0026plusmn;\u0026thinsp;7.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.279\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBMI (Kg m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e25.63\u0026thinsp;\u0026plusmn;\u0026thinsp;6.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e26.68\u0026thinsp;\u0026plusmn;\u0026thinsp;4.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.167\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eThe BMI stands for body mass index\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eBMP15\u003c/b\u003e \u003cb\u003eGenotyping\u003c/b\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe electrophoretic pattern of the PCR products of the \u003cem\u003eBMP15\u003c/em\u003e gene on the 3% agarose gel shows three distinct genotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). The genotypes are C/C (homozygous major allele) \u0026ndash; a single 342-bp fragment; C/T (heterozygous) \u0026ndash; three fragments of 342, 187 and 160 bp; T/T (homozygous minor allele) \u0026ndash; two fragments of 160 and 187 bp.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGenotype and allele frequencies of the \u003cem\u003ers104894766\u003c/em\u003e polymorphism were presented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Accordingly, the association between the genotypes of this polymorphism and the risk of endometriosis can be determined. The CT genotype showed no significant association with endometriosis (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.2, OR\u0026thinsp;=\u0026thinsp;0.72, 95% CI 0.39\u0026ndash;1.32). Comparison of the allele frequencies between the control and patient groups likewise indicated that the T allele was only slightly associated with the risk of endometriosis (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.06, OR\u0026thinsp;=\u0026thinsp;0.66, 95% CI 0.42\u0026ndash;1.03).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenotype and allele frequency distribution of the \u003cem\u003eBMP15 rs104894766\u003c/em\u003e polymorphism in patient and control groups\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCase\u003c/p\u003e \u003cp\u003en (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003cp\u003en (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOR (% 95 CI)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (Reference)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.72 (0.39\u0026ndash;1.32)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.48 (0.19\u0026ndash;1.23)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAllele\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e137\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e152\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (Reference)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.66 (0.2\u0026ndash;1.03)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.06\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe CI and OR stand for condifence interval and the odds ratio, respectively\u003c/p\u003e \u003cp\u003e \u003cb\u003eWNT4\u003c/b\u003e \u003cb\u003eGenotyping\u003c/b\u003e\u003c/p\u003e \u003cp\u003eRegarding the PCR products of the \u003cem\u003eWNT4\u003c/em\u003e genes on a 3% agarose gel (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb), there exist one fragment of 368 base pairs for G/G dominant homozygous, three fragments of 368, 208, and 160 base pairs for G/A heterozygous, and two fragments of 208 and 160 base pairs for A/A recessive homozygous. In lane 2, three bands of 368, 208, and 160 base pairs were observed which means the genotype of this individual for \u003cem\u003eWNT4\u003c/em\u003e (\u003cem\u003ers121908652\u003c/em\u003e) is G/A heterozygous. In lane 3, only one band of 368 base pairs was observed which means the genotype of this individual for \u003cem\u003eWNT4\u003c/em\u003e (\u003cem\u003ers121908652\u003c/em\u003e) is G/G dominant homozygous. In lane 4, two bands of 160 and 208 base pairs were observed which means the genotype of this individual for \u003cem\u003eWNT4\u003c/em\u003e (\u003cem\u003ers121908652\u003c/em\u003e) is A/A recessive homozygous.\u003c/p\u003e \u003cp\u003eThe genotypes of patients and controls for the \u003cem\u003eWNT4 rs121908652\u003c/em\u003e polymorphism consisted of 48 cases of G/G homozygous dominant, 43 cases of G/A heterozygous, and 9 cases of A/A homozygous recessive (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e); while the genotype of the control group for the WNT4 gene polymorphism includes 65 cases of G/G homozygous dominant, 29 cases of G/A heterozygous, and 6 cases of A/A homozygous recessive. The statistical analysis of the results indicates a significant relationship between the \u003cem\u003eWNT4 rs121908652\u003c/em\u003e polymorphism and endometriosis at a \u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenotype and allele frequency distribution of the \u003cem\u003eWNT4 rs121908652\u003c/em\u003e polymorphisms in control and patient groups\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype\u003c/p\u003e \u003cp\u003e\u003cem\u003eWNT4\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCase\u003c/p\u003e \u003cp\u003en (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003cp\u003en (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOR (% 95 CI)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eP value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (Reference)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.5 (0.27\u0026ndash;0.91)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.02\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.49 (0.16\u0026ndash;1.48)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAllele\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e139\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e159\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (Reference)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.59 (0.37\u0026ndash;0.93)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.02\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe CI and OR stand for condifence interval and the odds ratio, respectively; the \u003cem\u003ep\u003c/em\u003e values with asterisk (\u003csup\u003e*\u003c/sup\u003e) shows the statistical significant differences.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eEndometriosis and infertility are both multifactorial and polygenic diseases. Several genetic variants have been examined in relation to endometriosis, and their polymorphisms have been studied in different populations worldwide. Given the genetic background of the Iranian population and the population-specific nature of many polymorphisms, investigation of endometriosis-related polymorphisms in Iranian population is important for future research worldwide. There were significant research and advancements in the diagnosis and treatment of infertility and endometriosis, with approximately 65% of infertile couples achieving parenthood using new methods and available technologies \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Genetic variants also play a pivotal role in female fertility, influencing cellular and physiological processes essential for fertility, particularly within the \u003cem\u003eWNT-BMP\u003c/em\u003e gene family \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Different reports suggest this gene family is truly involved in development of several developmental processes such as anterior-posterior axis and oocytes development in the female reproductive and therefore fertility \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eFor example, members of the \u003cem\u003eBMP\u003c/em\u003e family, particularly \u003cem\u003eBMP15\u003c/em\u003e, acts a growth factor for oocyte derivatives by regulating proliferation and granulosa cell differentiation \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. It was reported that mutations in \u003cem\u003eBMP\u003c/em\u003e-family genes cause infertility in females \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. The heterozygote mutation in the \u003cem\u003eBMP15\u003c/em\u003e gene was diagnosed as infertile women due to ovarian hypergonadotropic failure \u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. The \u003cem\u003eBmp15\u003c/em\u003e polymorphism has a profound impact on oocyte maturation in females \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Also, the \u003cem\u003eBmp15\u003c/em\u003e mRNA expression levels were associated with endometriosis in patients \u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn the present study, no significant association was observed between endometriosis and the \u003cem\u003eBmp15 rs104894766\u003c/em\u003e polymorphism in Iranian women. Consistently, the previous studies only reported association between \u003cem\u003eBMP15\u003c/em\u003e gene polymorphism and diminished ovarian reserve \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e and reduced ovarian response \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e, without any direct relationship with endometriosis in patients.\u003c/p\u003e \u003cp\u003eIn the present work, there was a significant association between the \u003cem\u003eWNT4\u003c/em\u003e (rs121908652) polymorphism and endometriosis in Iranian women. The mentioned polymorphism frequencies had an extensive increase in patients and controls. Both groups were of nearly the same age groups and body mass indexes. These characteristics were found to influence endometriosis so that the lower BMI was discussed to be related to the risk factor \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Accordingly, we conducted the study within the young adult groups of nearly the same body weight to address any concerns regarding the impact of these traits on the results of the present investigation. In the present study, the GG genotype frequency of \u003cem\u003eWNT4\u003c/em\u003e (rs121908652) was 48% and 65%, the GA genotype was 43% and 29% and the AA genotype was 9% and 6%, with \u003cem\u003ep\u003c/em\u003e value of 0.02, suggesting that this polymorphism is related with endometriosis.\u003c/p\u003e \u003cp\u003eIn Brazilian population, the association between four single nucleotide polymorphisms (SNPs) in \u003cem\u003eWNT4\u003c/em\u003e gene family was studied, and only the \u003cem\u003ers16826658\u003c/em\u003e and \u003cem\u003ers3820282\u003c/em\u003e polymorphisms were associated with endometriosis \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. In Chinese Han women, there was an association between \u003cem\u003eWnt4\u003c/em\u003e (\u003cem\u003ers2235529\u003c/em\u003e) polymorphism and endometriosis risk, while no significant association was found between endometriosis risk and three other SNPs (\u003cem\u003ers7521902, rs16826658\u003c/em\u003e, and \u003cem\u003ers7515106\u003c/em\u003e) \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. In a Greek population, the SNP \u003cem\u003ers7521902\u003c/em\u003e in the \u003cem\u003eWNT4\u003c/em\u003e gene was found significantly associated with endometriosis patients at genotypic level \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Accordingly, not all polymorphisms can be related to endometriosis. The genetic background of each specific population is unique and different from other populations. Additionally, it is also well known that the ultimate role of a gene or genetic variant in a particular disease is determined by its interaction with environmental factors and other genes. Thus, it is expected to observe different results due to environmental factors that has roots in societal and cultural differences as well as the level of societal advancement and the predominant lifestyle within a population \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. The present findings in Iranian population can be insightful for our understanding of etiology of endometriosis and early diagnosis.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study found a correlation between the clinical and genetic findings with endometriosis risk in adult Iranian women. The \u003cem\u003eWNT4 rs121908652\u003c/em\u003e polymorphism is associated with endometriosis. There was no signific relationship between the \u003cem\u003eBMP15 rs104894766\u003c/em\u003e polymorphism and endometriosis in Iranian women at the genotypic level. The \u003cem\u003eWNT4 rs121908652\u003c/em\u003e polymorphism may be a genetic risk factor for endometriosis in adult women.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors Contribution\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSRA and SMK contributed to the conceptualization, methodology, data validation, formal analysis, and visualization. SRA conducted investigation, data curation, and writing original draft. SMK prepared resources, review and editing, supervision, and project administration. Both authors have read the final manuscript and agreed to be submitted for publication.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors acknowledge the support of Islamic Azad University for providing the research facilities to accomplish this work. Proof reading and editing services by Hamyarapply Group (Tehran-Iran) is greatly appreciated.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work has received no specific funding under a special grant number.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInformed Consent Statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the participants were informed about the tests and also further publication of the results. Then the informed consent was obtained from all the subjects engaged with the study. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data generated or analyzed during this study are included in this article, the supplementary information, and the dbSNP repository with the following web links:\u003c/p\u003e\n\u003cp\u003ehttps://www.ncbi.nlm.nih.gov/snp/?term=rs121908652\u003c/p\u003e\n\u003cp\u003ehttps://www.ncbi.nlm.nih.gov/snp/?term=rs104894766\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLyu, S. et al. Identification of candidate microRNA biomarkers of endometriosis in different bodily fluids. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 6218 (2026).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParasar, P., Ozcan, P. \u0026amp; Terry, K. L. Endometriosis: epidemiology, diagnosis and clinical management. \u003cem\u003eCurr. Obstet. Gynecol. Rep.\u003c/em\u003e \u003cb\u003e6\u003c/b\u003e, 34\u0026ndash;41 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgarwal, N. \u0026amp; Subramanian, A. Endometriosis - Morphology, clinical presentations and molecular pathology. \u003cem\u003eJ. Lab. Physicians\u003c/em\u003e. \u003cb\u003e2\u003c/b\u003e, 1\u0026ndash;9 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHorne, A. W. \u0026amp; Missmer, S. A. Pathophysiology, diagnosis, and management of endometriosis. \u003cem\u003eBMJ\u003c/em\u003e \u003cb\u003e379\u003c/b\u003e, e070750 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBallard, K., Lane, H., Hudelist, G., Banerjee, S. \u0026amp; Wright, J. Can specific pain symptoms help in the diagnosis of endometriosis? A cohort study of women with chronic pelvic pain. \u003cem\u003eFertil. Steril.\u003c/em\u003e \u003cb\u003e94\u003c/b\u003e, 20\u0026ndash;27 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMafra, F., Catto, M., Bianco, B., Barbosa, C. P. \u0026amp; Christofolini, D. Association of WNT4 polymorphisms with endometriosis in infertile patients. \u003cem\u003eJ. Assist. Reprod. Genet.\u003c/em\u003e \u003cb\u003e32\u003c/b\u003e, 1359\u0026ndash;1364 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaas, D. et al. Endometriosis: a premenopausal disease? Age pattern in 42,079 patients with endometriosis. \u003cem\u003eArch. Gynecol. Obstet.\u003c/em\u003e \u003cb\u003e286\u003c/b\u003e, 667\u0026ndash;670 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElizur, S. E., Mostafa, J., Berkowitz, E. \u0026amp; Orvieto, R. Endometriosis and infertility: pathophysiology, treatment strategies, and reproductive outcomes. \u003cem\u003eArch. Gynecol. Obstet.\u003c/em\u003e \u003cb\u003e312\u003c/b\u003e, 1037\u0026ndash;1048 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTreloar, S. A. et al. Genomewide linkage study in 1,176 affected sister pair families identifies a significant susceptibility locus for endometriosis on chromosome 10q26. \u003cem\u003eAJHG\u003c/em\u003e 77, 365\u0026ndash;376 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBischoff, F. Z. \u0026amp; Simpson, J. L. Heritability and molecular genetic studies of endometriosis. \u003cem\u003eHum. Reprod. Update\u003c/em\u003e. \u003cb\u003e6\u003c/b\u003e, 37\u0026ndash;44 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVigan\u0026ograve;, P., Parazzini, F., Somigliana, E. \u0026amp; Vercellini, P. Endometriosis: epidemiology and aetiological factors. \u003cem\u003eBest Pract. Res. Clin. Obstet. Gynecol.\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e, 177\u0026ndash;200 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, S., Huang, G., Hu, Q. \u0026amp; Zou, Q. A network-based method for the identification of putative genes related to infertility \u003cem\u003eBiochimica et Biophysica Acta-General Subjects\u003c/em\u003e 1860, 2716\u0026ndash;2724 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Q. et al. Roles and action mechanisms of WNT4 in cell differentiation and human diseases: A review. \u003cem\u003eCell. Death Discovery\u003c/em\u003e. \u003cb\u003e7\u003c/b\u003e, 287 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGajbhiye, R., Fung, J. N. \u0026amp; Montgomery, G. W. Complex genetics of female fertility. \u003cem\u003eNPJ Genomic Med.\u003c/em\u003e \u003cb\u003e3\u003c/b\u003e, 29 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVainio, S., Heikkila, M., Kispert, A., Chin, N. \u0026amp; McMahon A. P. Female development in mammals is regulated by Wnt-4 signalling \u003cem\u003eNature\u003c/em\u003e 397, 405\u0026ndash;409 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJordan, B. K. et al. Up-regulation of Wnt-4 signalling and dosage-senstitive sex reversal in humans. \u003cem\u003eAm. J. Hum. Genet.\u003c/em\u003e \u003cb\u003e68\u003c/b\u003e, 1102\u0026ndash;1109 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDetmer, K. \u0026amp; Walker, A. N. Bone morphogenetic proteins act synergistically with haematopoietic cytokines in the differentiation of haematopoietic progenitors. \u003cem\u003eCytokine\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e, 36\u0026ndash;42 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDucy, P. \u0026amp; Karsenty, G. The family of bone morphogenetic proteins. \u003cem\u003eKidney Int.\u003c/em\u003e \u003cb\u003e57\u003c/b\u003e, 2207\u0026ndash;2214 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalters, M. J. et al. Calmodulin-dependent protein kinase IV mediated antagonism of BMP signaling regulates lineage and survival of hematopoietic progenitors. \u003cem\u003eDevelopment\u003c/em\u003e \u003cb\u003e129\u003c/b\u003e, 1455\u0026ndash;1466 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlarmo, E. L., Kuukasj\u0026auml;rvi, T., Karhu, R. \u0026amp; Kallioniemi, A. A comprehensive expression survey of bone morphogenetic proteins in breast cancer highlights the importance of BMP4 and BMP7. \u003cem\u003eBreast Cancer Res. Treat.\u003c/em\u003e \u003cb\u003e103\u003c/b\u003e, 239\u0026ndash;246 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalloway, S. M. et al. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. \u003cem\u003eNat. Genet.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 279\u0026ndash;283 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBougie, O., Nwosu, I. \u0026amp; Warshafsky, C. Revisiting the impact of race/ethnicity in endometriosis \u003cem\u003eReproduction Fertility\u003c/em\u003e \u003cb\u003e3\u003c/b\u003e, 34\u0026ndash;41 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoormohammadi, M. et al. Mediterranean diet adherence and healthy diet indicator might decrease odds of endometriosis. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 36750 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHojati, V. The role of gene polymorphisms in infertility, polyendocrine metabolic ovarian syndrome and recurrent miscarriage in the Iranian women population: A review study. \u003cem\u003eInt. J. Reproductive Biomed.\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e, 585\u0026ndash;604 (2026).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoyer, A. et al. WNT4 is required for normal ovarian follicle development and female fertility. \u003cem\u003eFASEB J.\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e, 3010\u0026ndash;3025 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWiweko, B. et al. BMP15 mRNA profile in granulosa cells from endometriosis patients undergoing in vitro fertilization. \u003cem\u003eJ. Phys.\u003c/em\u003e \u003cb\u003e1073\u003c/b\u003e, 032052 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLedig, S., R\u0026ouml;pke, A., Haeusler, G., Hinney, B. \u0026amp; Wieacker, P. BMP15 mutations in XX gonadal dysgenesis and premature ovarian failure. \u003cem\u003eAm. J. Obstet. Gynecol.\u003c/em\u003e \u003cb\u003e198\u003c/b\u003e, 84e81\u0026ndash;84e85 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhasemifar, S. et al. Association of P73, BMP15, and GDF9 gene polymorphisms with diminished ovarian reserve. \u003cem\u003eBiomedical Res. Therapy\u003c/em\u003e. \u003cb\u003e11\u003c/b\u003e, 6941\u0026ndash;6949 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeireles, A. J. C. et al. Association of FSHR, LH, LHR, BMP15, GDF9, AMH, and AMHR polymorphisms with poor ovarian response in patients undergoing in vitro fertilization. \u003cem\u003eJBRA Assist. Reprod.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 439\u0026ndash;446 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRowlands, I. J., Hockey, R., Abbott, J. A., Montgomery, G. W. \u0026amp; Mishra, G. D. Body mass index and the diagnosis of endometriosis: Findings from a national data linkage cohort study. \u003cem\u003eObes. Res. Clin. Pract.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 235\u0026ndash;241 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, Z. et al. Analysis of WNT4 polymorphism in Chinese Han women with endometriosis. \u003cem\u003eReprod. Biomed. Online\u003c/em\u003e. \u003cb\u003e30\u003c/b\u003e, 415\u0026ndash;420 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatalliotakis, M. et al. The role of gene polymorphisms in endometriosis. \u003cem\u003eMol. Med. Rep.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 5881\u0026ndash;5886 (2017).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Endometriosis, single nucleotide polymorphism, BMP15 gene, WNT4 gene, infertile women, Iranian population","lastPublishedDoi":"10.21203/rs.3.rs-11064757/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-11064757/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEndometriosis is a multifactorial and polygenic disorder with a strong genetic aspect in endometrium characterized by the presence of endometrial tissue outside the uterine cavity. This disorder is associated with pelvic pain and infertility in women. The present work aimed at investigating the association between the risk of endometriosis in Iranian women and the polymorphisms in \u003cem\u003eBMP15 rs104894766\u003c/em\u003e and \u003cem\u003eWNT4 rs121908652\u003c/em\u003e. In the present case-control study, the variants were investigated in 100 patient women with endometriosis and 100 healthy subjects (both groups aged 20\u0026ndash;35 years old) using PCR-RFLP methods. Statistical analysis was performed with SPSS software using the χ\u0026sup2; test and calculation of the odds ratios (OR) at 95% confidence intervals. There was significant association between the risk of endometriosis and the \u003cem\u003eWnt4 rs12190865\u003c/em\u003e polymorphism (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.02, OR\u0026thinsp;=\u0026thinsp;0.5) at genotypic and allele levels. No significant association was observed between endometriosis and the \u003cem\u003eBMP15 rs104894766\u003c/em\u003e polymorphism (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.2, OR\u0026thinsp;=\u0026thinsp;0.72). The polymorphisms in the \u003cem\u003eWnt4\u003c/em\u003e gene might be related to the pathogenesis of endometriosis in infertile adult women.\u003c/p\u003e","manuscriptTitle":"Association of Wnt4 (rs121908652) and Bmp15 (rs104894766) polymorphisms with endometriosis risk in Iranian women","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-10-23 01:11:29","doi":"10.21203/rs.3.rs-11064757/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"125885976193495780107396322374583658919","date":"2026-10-12T03:03:55+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"134823573220109570262190840302756907030","date":"2026-10-10T16:16:26+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-10-09T12:05:18+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-10-07T10:48:09+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-09-28T18:03:37+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-09-24T06:12:37+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2026-09-23T08:52:17+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"36ac71c1-9759-4e10-824b-a656d58f968d","owner":[],"postedDate":"October 23rd, 2026","published":true,"recentEditorialEvents":[{"type":"reviewerAgreed","content":"125885976193495780107396322374583658919","date":"2026-10-12T03:03:55+00:00","index":41,"fulltext":""},{"type":"reviewerAgreed","content":"134823573220109570262190840302756907030","date":"2026-10-10T16:16:26+00:00","index":40,"fulltext":""},{"type":"reviewersInvited","content":"4","date":"2026-10-09T12:05:18+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-10-07T10:48:09+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":78282035,"name":"Health sciences/Diseases"},{"id":78282036,"name":"Health sciences/Endocrinology"},{"id":78282037,"name":"Biological sciences/Genetics"},{"id":78282038,"name":"Health sciences/Medical research"},{"id":78282039,"name":"Health sciences/Risk factors"}],"tags":[],"updatedAt":"2026-10-23T01:11:29+00:00","versionOfRecord":[],"versionCreatedAt":"2026-10-23 01:11:29","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-11064757","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-11064757","identity":"rs-11064757","version":["v1"]},"buildId":"uzvnyPIH0yfUW73ClG4p1","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}