The SOX18-OTUB1-YAP1 axis: a new endometriosis target

Background EMS (Endometriosis) is characterized by the presence of functional endometrial tissue outside the uterus and is one of the most common gynecological disorders. SOX18 (SYR-related high-mobility group box 18) is a transcription factor whose expression is higher in ectopic endometrial tissues than in eutopic endometrial tissues. However, its role in EMS has not been confirmed.

Here, immunohistochemistry (IHC) staining was used to analyze the expression pattern of SOX18 in EMS. Next, the effects of SOX18 on cell viability, migration and invasion were investigated. Dual-luciferase reporter assay, chromatin-immunoprecipitation (ch-IP) and DNA pull-down were employed to verify SOX18 binding to the OTUB1 (OTU domain-containing ubiquitin aldehyde binding protein 1) promoter. In addition, co-immunoprecipitation (co-IP) was used to analyze the binding of OTUB1 to YAP1 (Yes-associated protein 1). Allograft mouse model of EMS was established to explore the role of SOX18 in vivo.

In vitro results demonstrated that upregulation of SOX18 promoted the proliferation, migration and invasion of Ishikawa cells and induced the EMT process, while knockdown of SOX18 showed the opposite effect. In vivo results also confirmed that SOX18 overexpression led to the deterioration of EMS, as reflected by significant pathological changes in mice. Mechanistically, our data proved that SOX18 directly bound to the OTUB1 promoter region and activated its transcription. Further investigation demonstrated that OTUB1 deubiquitinated YAP1 and enhanced its protein stability. Rescue experiments suggested that SOX18 modulated YAP1 expression through upregulating OTUB1, indicating the role of SOX18-OTUB1-YAP1 axis in EMS.

These discoveries underscore that SOX18 contributes to the pathogenesis of EMS through promoting OTUB1 transcription and activating Hippo/YAP1 signaling pathway, which may provide a new therapeutic target for EMS.

Endometriosis, SOX18, Hippo/YAP1, OTUB1 The SOX18-OTUB1-YAP1 axis: a new endometriosis target Ying Feng1* , Jiamei Yue1, Si Fan1 and Jiayan Wu1 Page 2 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647

EMS (Endometriosis) is a common, chronic, inflam - matory, and hormone-dependent gynecological disor - der that is usually characterized by ectopia outside the uterine cavity, the presence and growth of endometrioid tissue. It predominantly affects about 10% of women of reproductive age [ 1, 2]. EMS is associated with multiple symptoms, such as pelvic pain, dysmenorrhea, dyspareu - nia, urinary dysfunction, and related fertility problems [3]. Although it is benign, this chronic and multifacto - rial disease exhibits tumor-like biological behavior and affects the physical and mental health of the affected women [ 4]. Current treatments include surgical resec - tion of the lesion and drug therapy, but conventional treatment is limited by the high rate of postoperative recurrence and the side effects of drugs [ 5]. Therefore, understanding the molecular mechanisms driving EMS progression is crucial for identifying diagnostic biomark - ers and developing effective therapies. SOX18 (SYR-related high-mobility group box 18) is a member of the SOX transcription factor family and is involved in a variety of biological processes, including cardiovascular development, cell-fate determination, and tissue homeostasis [ 6]. An increasing number of studies demonstrated that SOX18 was highly expressed in tumor tissues and exacerbated their development, such as hepatocellular carcinoma [ 7], bladder cancer [8], gastric cancer [ 9], clear cell renal cell carcinoma [ 10] and prostate cancer [ 11]. In addition, SOX18 promoted TNF-α-induced airway smooth muscle cell proliferation and migration via regulating Notch1 signaling pathway, thus aggravating the progression of childhood asthma [12]. By analyzing the GSE11691 chip of GEO database, it was found that SOX18 expression was significantly upregulated in ectopic endometrial tissues compared with eutopic endometrial tissues, but its role in EMS was unknown. Hippo signaling pathway plays an important role in a variety of biological processes such as organ size control, tissue homeostasis, cancer genesis, and immune response [13]. As the main downstream target of Hippo pathway, YAP1 (Yes-associated protein 1) is involved in the occur - rence and development of multiple cancers. For example, YAP1 initiated gastric tumorigenesis through upregula - tion of MYC [ 14]. YAP1 also facilitated invasion, metas - tasis, and epithelial-mesenchymal transformation (EMT) of non-small cell lung cancer cells [15]. In addition, a pre- vious study certified that activation of the Hippo/YAP1 pathway promoted ectopic endometrial stromal cell pro - liferation and anti-apoptosis [16]. OTUB1 (OTU domain-containing ubiquitin aldehyde binding protein 1) is a deubiquitinating enzyme that blocks ubiquitination, resulting in protein stabilization [17]. OTUB1 has been identified to drive the progression of a variety of tumors. For instance, OTUB1 instigated cancer cell immunosuppression by stabilizing PD-L1 [18]. OTUB1 fostered breast cancer progression via blocking MYC protein degradation [ 19]. Noteworthily, OTUB1 promoted the pathogenesis of EMS through upregulating HSF119 [20]. Through the analysis of Jaspar database, we noticed there were potential binding sites for SOX18 on the promoter of OTUB1. Accordingly, it was speculated that SOX18 may play a key role in EMS by regulating OTUB1 transcription. In addition, hitpredict database indicated a possible combination of OTUB1 and YAP1. Remarkably, Yan et al. demonstrated that OTUB1 aggra - vated gastric cancer progression by stabilizing YAP1 [21]. However, whether OTUB1-YAP1 axis affects the role of SOX18 in EMS remains to be explored. In this study, we aimed to investigate the role of SOX18 in EMS and the molecular mechanism of the SOX18- OTUB1-YAP1 axis. Our results may contribute to the development of appropriate therapeutic strategies.

Clinical samples The clinical study was approved by the Medical Ethics Committee of the Second Affiliated Hospital of Nan - chang University and conducted in accordance with the Declaration of Helsinki. All subjects provided written informed consent prior to participation. Nine ectopic endometrium samples (28–46 years old, n = 4 prolifera- tive and n = 5 secretory) with laparoscopically and his - topathologically confirmed endometriosis (EMS) and 18 eutopic endometrium samples (28–54 years old, n = 11 proliferative and n = 7 secretory) without evidence of EMS by laparoscopy were included in this study. All patients had regular menstrual cycles and none of them had received hormonal treatment for at least 3 months prior to the surgery. Eutopic endometrial biopsy speci - mens were collected using endometrial aspiration cathe - ters. Endometriotic cyst walls were collected and ectopic endometrial tissues were carefully stripped from the lin - ing inner cyst wall. Paraffin-embedded eutopic endome - trium and ectopic endometrium samples were used for immunohistochemistry (IHC) staining to detect SOX18 expression. Differential gene analysis GSE11691 (containing ectopic endometrium ( n = 9) samples and eutopic endometrium ( n = 9) samples) gene expression profile was downloaded from the GEO data - base ( h t t p s : / / w w w . n c b i . n l m . n i h . g o v / g e o /). The fi l t e r i n g conditions for differentially expressed genes (DEGs) between ectopic and eutopic endometrial tissue samples were:|log2FC|>1, p < 0.01. At last, GO and KEGG enrich - ment analyses were performed to explore important pathways. Page 3 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647 Allograft mouse model of EMS The animal experiments were in lined with Guide for the Care and Use of Laboratory Animals, and approved by Ethics Committee of the Nanchang University. EMS was induced by a previously described method [ 22]. Eight- week-old female C57BL/6J mice were used for model - ing. One week before EMS induction surgery, mice were subcutaneously injected with estradiol valerate (0.2  mg/ mouse). The donor mice were then killed, the uterine horns removed and placed in a dish containing ster - ile saline. After stripping the serosa and myometrium, the endometrium-rich fragments were shredded. Pro - cessed fragments are always smaller than 1 mm 3. Frag - ments suspended in sterile saline were intraperitoneally injected into recipient mice. Fragments of endometrial tissue obtained from one mouse were injected into two mice. Mice in sham group were injected with the same volume of normal saline intraperitoneally. One week after transplantation of donor endometrial fragments, recipi - ent mice were intraperitoneally injected with SOX18 overexpression or control adenovirus (1 × 109 pfu, volume no more than 1 ml). Three weeks later, a second injection of adenovirus was administered. The recipient mice were sacrificed 42 days after transplantation of donor endome- trial fragments, and the recipient mice were dissected to obtain ectopic endometrial tissues, and endometrial tis - sues of the sham group were also collected. Histology and IHC staining H&E staining was used to detect the pathological changes of ectopic endometrium in recipient mice. Tis - sues were embedded in paraffin and cut into 5 μm-thick sections. Sections were deparaffinized in xylene and dehydrated with graded ethanol. Afterwards, sections stained with hematoxylin (Solarbio, Beijing, China) for 5  min and eosin (Sangon Biotech, Shanghai, China) for 3  min. Finally, the staining was observed under a DP73 microscope (Olympus, Japan). For IHC staining, paraffin-embedded sections were deparaffinized and rehydrated, and the endogenous per - oxidase was blocked with 3% H 2O2. Primary antibod - ies (anti-SOX18, bs-17135R, 1: 100, BIOSS, Changzhou, China; anti-OTUB1, GTX101973, 1: 100, GeneTex, USA; anti-Vimentin, A19607, 1: 100, ABclonal, Shang - hai, China) were added and incubated overnight at 4 °C, followed by incubation with HRP-conjugated secondary antibody (31460, 1: 500, ThermoFisher, USA) at 37  °C for 30  min. Subsequently, sections were incubated with DAB (MXB® Biotechnology, Fuzhou, China), stained with hematoxylin and finally pictured under a DP73 microscope. Cell culture and transfection Ishikawa cells were purchased from iCell Bioscience Inc (Shanghai, China) and cultured in MEM medium (Solar - bio, Beijing, China) containing 15% fetal bovine serum at 37℃ and 5% CO2. To overexpress SOX18 and OTUB1, we amplified the cDNA of SOX18 or OTUB1 and subcloned them into pcDNA3.1. For the knockdown of SOX18, OTUB1 and YAP1, we synthesized shRNA targeting these genes and subcloned them into pRNAH1.1 with the following sequences: shSOX18#1: G A G T T C G A C C A G T A C C T C A A T T C A A G A G A T T G A G G T A C T G G T C G A A C T T T T T T. shSOX18#2: G G G G C A A A G G A C G A G C G C A A T T C A A G A G A T T G C G C T C G T C C T T T G C C C T T T T T. shOTUB1: G C C G A C T A C C T T G T G G T C T A T T C A A G A G A T A G A C C A C A A G G T A G T C G G T T T T T. shYAP1: G G G T C A G A G A T A C T T C T T A A T T C A A G A G A T T A A G A A G T A T C T C T G A C C T T T T T. Ishikawa cells were transfected with the overexpres - sion plasmids or shRNA plasmids using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer’s protocols. Cell viability CCK-8 kit (Solarbio) was employed to detect cell viability at 0, 24, 48 and 72  h after transfection. Optical density (OD) values were measured at 450  nm with microplate reader 800TS (BioTek, USA). Cell invasion and migration Transwell assays were used to evaluate cell migration and invasion. Briefly, 200 µl cell suspension was added to the upper chamber and precoated with/without Matrigel gel (Corning, USA). Medium supplemented with 10% FBS was added to the lower chamber. Afterwards, cells were allowed to migrate or invade into the lower chamber. After washing with PBS, cells were fixed with 4% poly - formaldehyde for 20  min and stained with 0.5% crystal violet (Amresco, USA) for 5 min. Finally, cells were coun- terstained and photographed with a DP73 microscope. Immunofluorescence double staining Cells were fixed with 4% paraformaldehyde and incu - bated with 0.1% tritonX-100 (Beyotime, Shanghai, China) at room temperature for 30 min. After blocking with 1% BSA, cells were incubated with primary antibodies (anti- OTUB1, 1: 100, ab270959, Abcam, UK and anti-YAP1, 1: Page 4 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647 50, sc-271134, Santa Cruz Biotechnology, USA) at 4  °C overnight, followed by incubation with secondary anti - bodies (FITC-labeled goat anti-rabbit IgG, ab6717, 1: 200, Abcam) or (Cy3-labeled goat anti-mouse IgG, ab97035, 1: 200, Abcam) at room temperature for 1 h. After that, sec- tions were treated with DAPI (Aladdin, Shanghai, China), and the staining was observed under DP73 microscope. Real-time PCR Total RNA was extracted by TRIpure (BioTeke, Beijing, China). cDNA was obtained by All-in-One First-Strand SuperMix (Magen, Guangzhou, China). Real-time PCR was performed using 2×Fast Taq plus PCR Master Mix (Biosharp, Hefei, China) and SYBR Green (Solarbio) in Pangaea 3 fluorescence quantifier (Aperbio, Suzhou, China). The expression of targeted genes was analyzed with a 2 −ΔΔCt method. GAPDH was used as an internal control. Primers used are shown in Table 1. Western blot Tissue and cell lysates were prepared with RIPA buf - fer (Solarbio) containing 10% PMSF (Solarbio). Next, protein concentrations were quantified using a BCA kit (Solarbio). Samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on a 10% gel (Solarbio) and transferred to a polyvinylidene fluoride membrane (Millipore, USA). Membranes were incubated with primary antibodies at 4 °C overnight and goat anti- rabbit HRP-conjugated IgG (SE134, 1: 3000, Solarbio) or goat anti-mouse HRP-conjugated IgG (SE131, 1: 3000, Solarbio) at 37 °C for 1 h. Next, membranes were devel - oped with electrochemiluminescence regent (Beyotime) for 5  min and visualized by Tanon Image (Shanghai, China). Primary antibodies used are as follows: anti-SOX18 (R381018, 1: 500, Zen-bioscience, Chengdu, China), anti-YAP1 (sc-271134, 1:300; Santa Cruz), anti-OTUB1 (ab270959, 1: 1000, Abcam), anti-PCNA (200947-2E1, 1: 1000, Zen-bioscience), anti-E-cadherin (340341, 1:500, Zen-bioscience), anti-N-cadherin (240010, 1: 1000, Zen-bioscience), and anti-Vimentin (R22775, 1: 500, Zen-bioscience). Dual-luciferase reporter assay To determine the transcription activity of OTUB1, pGL3 luciferase reporter vector containing the OTUB1 pro - moter sequence was constructed and transfected into Ishikawa cells with SOX18 overexpression plasmid. pRL- TK was used as control plasmid. After 48 h of transfec - tion, cells were harvested, and luciferase activity was measured by the kit (Keygen Biotech, Nanjing, China). Chromatin-immunoprecipitation (Ch-IP) Ch-IP was performed using the kit (Beyotime) accord - ing to the manufacturers’ instructions. In brief, cells were cross-linked with 1% formaldehyde for 10  min at 37  °C and then broken down by ultrasonic treatment. After centrifugation, 70 µl Protein A/G beads were added and left for 30 min at 4 °C, and 20 µl sample was used as input. Afterwards, the mixture of DNA and protein was then incubated with 1  µg antibodies at 4  °C overnight. Samples were de-crosslinked with 20  µl 5  M NaCl at 65 °C for 4 h, and purified DNA fragments were extracted with phenol and chloroform for PCR. Co-immunoprecipitation (Co-IP) Cells were lysed in RIPA lysis buffer containing 10% PMSF (Solarbio), and protein was isolated. Antibodies were immobilized, and immunoprecipitation was then carried out using the co-IP kit (Pierce, USA) following the manufacturer’s protocol. Briefly, 200 µl IP cross-link- ing buffer was used to wash AminoLink conjugated resin. Next, lysates were added to the corresponding resin in which the corresponding antibodies had been cured. After elution, samples were applied for western blot. To evaluate ubiquitination of YAP1, Ishikawa treated with a 20 µM proteasome inhibitor MG132 for 8 h. West- ern blot was used to detect the ubiquitination levels of YAP1. Antibodies used are as follows: anti-YAP1 (sc- 271134, 1: 300, Santa Cruz Biotechnology), anti-OTUB1 (ab270959, 1: 1000, Abcam, UK), flag (R24091, 1: 5000, Zen-bioscience), myc (250112, 1: 5000, Zen-bioscience), and ubiquitin (381080, 1: 1000, Zen-bioscience). Protein stability Ishikawa cells were treated with 100 µg/ml CHX (Alad - din) for 0, 2, 4, 6 and 8 h. The residual rate of YAP1 pro - tein was calculated. Table 1 Primers used for real-time PCR assay Gene Primer sequences (5’-3’) Product size (bp) homo SOX18 F GGCAAAGCGTGGAAGGAG 101 homo SOX18 R TTGTAGTTGGGGTGGTCGC homo CTGF F AAATCTCCAAGCCTATCAAGTT 124 homo CTGF R GGCAGGGTGGTGGTTCT homo YAP1 F TGACCCTCGTTTTGCCATGA 125 homo YAP1 R GTTGCTGCTGGTTGGAGTTG homo OTUB1 F CTGTTTCTATCGGGCTTTC 235 homo OTUB1 R GGAGGTGCTCTGGTCATT homo ChIP-OTUB1 F GTGAAGCATACACCAGGAT 187 homo ChIP-OTUB1 R AGCCACCACTAAAGCAG mus SOX18 F CGTTTCCCAATCCTCTGTC 150 mus SOX18 R TAGTGGCATCCGGTCGA mus OTUB1 F TAGCGACTCCGAAGGTG 231 mus OTUB1 R AAGCAGTTGCCATCAGG Page 5 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647 DNA pull-down DNA pull-down was conducted with Sufficient reagents for 40 DNA pull down assay kit (BersinBio, Guangzhou, China) according to the manufacturer’s protocol. Briefly, nuclear protein was extracted, and 40  µl Agarose beads were added to the protein samples at 4  °C for 30  min. After centrifugation, protein samples were added with 500  µl binding buffer, 5  µl poly (dI·dC), 5  µl protease inhibitor, 5  µl DTT, 9  µl EDTA, 4.5  µl EGTA, and then added to the probe-magnetic bead complex. After incu - bation at 4  °C for 1  h, magnetic beads were collected. Finally, 15 µl protein samples were employed for western blot analysis. Statistical analysis GraphPad Prism 8 was utilized for data analysis. Differ - ences between the two groups were evaluated using Stu - dent’s t test. Comparisons among three or more groups were made using one-way ANOVA and Tukey’s post hoc tests. Pearson correlation analysis was used to evaluate the correlation between SOX18 and OTUB1. p < 0.05 was considered statistically significant.

The expression of SOX18 was significantly upregulated in GEO database and clinical samples of EMS In order to explore the potential factors of EMS, we first analyzed the GEO public database and obtained the expression data of GSE11691 chip. As revealed in volcano plot, 575 genes were significantly upregulated and 292 genes were significantly downregulated in ectopic endo - metrium compared with eutopic endometrium (Fig.  1A). To shed light on the biological function of DEGs, GO and KEGG pathway analysis was performed. The results dis - played that DEGs associated with GO annotation were enriched in regulation of cell-cell adhesion, cell chemo - taxis, cell growth, positive regulation of Hippo signaling, and DNA-binding transcription factor binding (Fig.  1B). DEGs enriched KEGG pathways were cell adhesion mol - ecules, ECM-receptor interaction and cytokine-cytokine receptor interaction (Fig.  1B). The above enriched path - ways indicated the pathogenic mechanism of EMS and provide possible directions for further study. SOX transcription factor family is involved in many biological processes, including cell proliferation, migra - tion and invasion. The role of members of the family of the SOX in EMS aroused our great interest. Therefore, we presented the expression of SOX family members in the GSE11691 chip by heat map (Fig.  1C). Among them, three SOX family members were identified as DEGs, including SOX18, SOX10 and SOX11. SOX18 and SOX10 were upregulated genes, and SOX11 was down - regulated genes. By querying the function of these DEGs, SOX18 was selected as a potential molecular target for follow-up study. As presented in Fig.  1D-E, SOX18 was highly expressed in ectopic endometrial tissues based on the data of GSE11691 microarray and IHC staining. These findings indicated that SOX18 may play a key role in the development of EMS. SOX18 overexpression promoted the proliferation of Ishikawa cells To further determine the potential function of SOX18 in EMS, we conducted a series of validation tests by overexpressing or silencing SOX18 in Ishikawa cells, respectively. SOX18 expression was downregulated by transfection with shRNA plasmid targeting SOX18, and its expression was upregulated by transfection with overexpression plasmid (Supplementary Fig.  1A). Sub - sequently, the impact of SOX18 on cell proliferation was detected. Findings from CCK-8 assay indicated that over- expression of SOX18 resulted in a noteworthy increase in OD450 values, while knockdown of SOX18 reduced cell viability (Fig.  2A). In addition, our data presented that SOX18 overexpression elevated PCNA and SOX18 expression, while SOX18 knockdown showed the oppo - site effect (Fig.  2B). These observations illustrated that SOX18 potentiated the proliferation of Ishikawa cells. SOX18 overexpression facilitated the migration, invasion and EMT of Ishikawa cells The influence of SOX18 on the migration and invasion of Ishikawa cells was investigated through Transwell assays with or without Matrigel-precoat. Overexpression of SOX18 significantly enhanced the migratory and inva - sive capabilities of cells, while silencing SOX18 had a sig - nificant effect on reversing migration characteristics and reducing invasiveness of cells (Fig.  3A). To further exam- ine whether SOX18 facilitates migration and invasion of cells by promoting EMT process, western blot analysis was employed to detect the expression of EMT mark - ers. As shown in Fig.  3B, the levels of epithelial markers (E-cadherin) were decreased, whereas, the levels of mes - enchymal markers (N-cadherin and vimentin) were obvi - ously elevated in SOX18-overexpressed cells. Conversely, the levels of EMT marker showed the opposite change in response to SOX18 knockdown (Fig.  3B). To sum up, our results demonstrated that SOX18 was involved in cell migration, invasion and EMT, thus leading to the process of EMS. SOX18 overexpression enhanced the Hippo/YAP1 signaling pathway in Ishikawa cells Previous GO enrichment analysis revealed that DEGs was enriched in regulation of Hippo signaling. Therefore, we characterized the mechanism by which SOX18 influ - ences the Hippo/YAP1 pathway. For western blot assay, SOX18 overexpression upregulated YAP1 expression, Page 6 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647 Fig. 1 The expression of SOX18 was significantly upregulated in GEO database and clinical samples of EMS. The data of GSE11691 gene expression profile were collected, and the DEGs screening criteria was │log2FC│>1, p < 0.01 for bioinformatics analysis. (A) Volcano plot of GSE11691 microarray data was used to display gene expression. ( B) GO and KEGG analysis were performed on the selected DEGs. ( C) The heat map showed the expression of all SOX family members in GSE11691 chip. (D) The expression of SOX18 in human endometrial tissues based on the data of GSE11691 microarray. (E) IHC staining was used to detect the expression of SOX18 in eutopic and ectopic endometrium of patients with EMS, and the staining results were analyzed by H-score. Scale bar: 50 μm. *, p < 0.05. ***, p < 0.001. Data are presented as mean ± SD Page 7 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647 while SOX18 knockdown inhibited its expression (Fig.  4A). Furthermore, the influence of SOX18 on the downstream factor of Hippo/YAP1 signaling path - way was examined. Of note, SOX18 overexpression enhanced the expression of CTGF, while SOX18 knock - down showed the opposite function (Fig.  4B). To gain a deeper understanding of the functional changes induced by SOX18, Ishikawa cells were transfected with shRNA plasmid targeting YAP1. After 48  h, the transfection efficiency of YAP1 was verified by real-time PCR and western blot (Fig.  4C). Next, cells were co-transfected with shRNA plasmid targeting YAP1 and SOX18 over - expression plasmid. As observed, YAP1 knockdown inhibited cell viability enhanced by SOX18 (Fig.  4D). Transwell assay also confirmed that SOX18 overexpres - sion promoted cell invasion, but this effect was nullified by YAP1 knockdown (Fig.  4E). In addition, YAP1 knock - down weakened the effect of SOX18 overexpression on EMT process, accompanied by increased E-cadherin and decreased N-cadherin and vimentin (Fig.  4F). Together, Fig. 3 SOX18 overexpression facilitated the migration, invasion and EMT of Ishikawa cells. (A) Transwell assay was used to determine cell migration and invasion. Scale bar: 100 μm. (B) The expression of E-cadherin, N-cadherin and Vimentin was examined by western blot. ***, p < 0.001. ****, p < 0.0001. Data are presented as mean ± SD Fig. 2 SOX18 overexpression promoted the proliferation of Ishikawa cells. (A) Cell viability was measured by CCK8 assay. (B) The expression of PCNA and SOX18 in the cells was detected by western blot. *, p < 0.05. ***, p < 0.001. ****, p < 0.0001. Data are presented as mean ± SD Page 8 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647 these findings suggested that SOX18 promoted the devel- opment of EMS by enhancing the Hippo/YAP1 signaling pathway. SOX18 transcriptionally upregulated the expression of OTUB1 A previous study verified that OTUB1 promoted the occurrence and development of EMS [ 20]. Jaspar data revealed potential SOX18 binding sites on the OTUB1 promoter, suggesting that SOX18 may be involved in the progression of EMS through transcriptional regulation of OTUB1. Therefore, we further elucidated the regulatory mechanism of SOX18 and OTUB1. Firstly, IHC stain - ing results indicated that the expression of OTUB1 was increased in ectopic endometrial tissues compared with eutopic endometrial tissues (Fig.  5A). Next, the correla - tion between SOX18 and OTUB1 in clinical samples was analyzed according to H-score. The results showed a pos- itive correlation between SOX18 and OTUB1 (Fig.  5B). Furthermore, we discovered that SOX18 overexpression upregulated the levels of OTUB1, while SOX18 knock - down downregulated its levels (Fig.  5C). The effect of SOX18 on the transcription of OTUB1 was evaluated by dual luciferase reporter assay. The results presented a sig- nificant increase in OTUB1 promoter activity as a result of SOX18 overexpression compared with vector, implying that SOX18 was required to facilitate the transcription of OTUB1 (Fig.  5D). The binding of SOX18 to the OTUB1 promoter was also verified by Ch-IP assay (Fig.  5E). In addition, as demonstrated by DNA pull-down, SOX18 wild-type bound to the promoter of OTUB1, but the SOX18 mutant did not bind to OTUB1 (Fig.  5F). Totally, our data confirmed that SOX18 bound to the OTUB1 promoter and transcriptionally upregulated OTUB1. Fig. 4 SOX18 overexpression enhanced the Hippo/YAP1 signaling pathway in Ishikawa cells. (A) The expression of YAP1 in the cells was tested by western blot. (B) The expression of CTGF in the cells was detected by real-time PCR. (C) Ishikawa cells were transfected with shRNA plasmid targeting YAP1. After 48 h, the transfection efficiency of YAP1 was analyzed by real-time PCR and western blot. (D) Cell viability was examined by CCK8 assay. (E) Transwell assay was used to test cell invasion. Scale bar: 100 μm. (F) The expression of E-cadherin, N-cadherin and Vimentin was detected by western blot. **, p < 0.01. ***, p < 0.001. ****, p < 0.0001. Data are presented as mean ± SD Page 9 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647 OTUB1 interacted with YAP1 and enhanced its protein stability Our previous results demonstrated that SOX18 tran - scriptionally activated OTUB1 and promoted the Hippo/ YAP1 signaling pathway. Notably, hitpredict analysis revealed the binding of OTUB1 to YAP1. Accordingly, we further clarified the molecular mechanism of OTUB1 and YAP1. Co-localization of OTUB1 and YAP1 in Ishikawa cells was detected by immunofluorescence double stain - ing. The results showed that OTUB1 and YAP1 were mainly colocalized in cytoplasm (Fig.  6A). Co-IP also used to verify the interaction of OTUB1 to YAP1 in cells (Fig. 6B). To further explore the binding region of the two proteins, HEK-293T was co-transfected with an overex - pression plasmid of different protein domains of OTUB1 (with a flag tag) and an overexpression plasmid of YAP1 (with a myc tag). The data certified that the OTU domain of OTUB1 combined with YAP1 (Fig.  6C). Furthermore, OTUB1 overexpression increased YAP1 levels, while OTUB1 knockdown showed the opposite effect (Fig. 6D). We further asked whether OTUB1 upregulates YAP1 expression through the proteasome pathway. To this end, Ishikawa cells were treated with 20 µM protease inhibitor MG132 for 8 h, and YAP1 expression was tested by west - ern blot. The results indicated that the levels of YAP1 were upregulated after the addition of MG132 to OTUB1 knockdown cells (Fig.  6E). Subsequently, the effect of OTUB1 on the half-life of YAP1 protein was investigated, and the results displayed that overexpression of OTUB1 inhibited its protein degradation (Fig.  6F). Notably, fur - ther assay suggested that OTUB1 overexpression medi - ated deubiquitination of YAP1 (Fig.  6G). Based on the above findings, we proved that OTUB1 deubiquitinated YAP1 and enhanced its protein stability. Fig. 5 SOX18 transcriptionally upregulated the expression of OTUB1. ( A) IHC staining was employed to test the expression of OTUB1 in eutopic and ectopic endometrium of patients with EMS, and the staining results were analyzed by H-score. Scale bar: 50 μm. ( B) Correlation between SOX18 and OTUB1 in clinical samples of EMS. ( C) The expression of OTUB1 in the cells was verified by real-time PCR and western blot. ( D) The luciferase reporter vector containing OTUB1 promoter sequence was co-transferred into Ishikawa cells with SOX18 overexpression plasmid. After 48 h, luciferase activity was detected by the kit. (E) The binding of the exogenous SOX18 and OTUB1 promoter was examined by Ch-IP , and the PCR products were detected by agarose gel electrophoresis. ( F) DNA pull-down analysis of SOX18 and OTUB1 promoter binding in Ishikawa cells. **, p < 0.01. ****, p < 0.0001. Data are presented as mean ± SD Page 10 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647 OTUB1 knockdown abolished the effect of SOX18 overexpression on EMS procession We further verified whether OTUB1 mediates the role of SOX18 in the regulation of EMS progression and Hippo/ YAP1 signaling pathway. Ishikawa cells were transfected with shRNA plasmid targeting OTUB1 and SOX18 over - expression plasmid. CCK8 experiment suggested that SOX18 overexpression promoted cell viability, while this effect was abolished OTUB1 knockdown (Fig.  7A). Furthermore, overexpression of SOX18 promoted cell invasion and EMT, whereas, knockdown of OTUB1 showed the opposite effect (Fig.  7B-C). SOX18 enhanced the Hippo/YAP1 signaling pathway, which was also coun- teracted by OTUB1 knockdown (Fig.  7D). Collectively, these findings indicated that OTUB1 knockdown abro - gated the impact of SOX18 overexpression on Ishikawa cells, implying that SOX18-OTUB1-YAP1 axis played a vital role during EMS. Fig. 6 OTUB1 interacted with YAP1 and enhanced its protein stability. (A) The co-localization of OTUB1 and YAP1 in Ishikawa cells was detected by immu- nofluorescence double staining. Scale bar: 50 μm. (B) Co-IP was used to verify the binding of OTUB1 to YAP1 in Ishikawa cells. (C) Overexpression plasmids of different protein domains of OTUB1 (with a flag tag) were co-transfected with YAP1 overexpression plasmid (with a myc tag) to HEK-293T. After 48 h, the binding of OTUB1 to YAP1 in the cells was determined by Co-IP . (D) Ishikawa cells were transfected with shRNA plasmid targeting OTUB1 or OTUB1 overexpressed plasmid. After 48 h, the expression of OTUB1 and YAP1 were detected by western blot. ( E) The expression of YAP1 in Ishikawa cells was examined by western blot after 20 µM MG132 treatment for 8 h. (F) Ishikawa cells were treated with 100 µg/ml CHX for 0, 2, 4, 6 and 8 h. The expression of YAP1 was detected by western blot, and the residual rate of YAP1 protein was calculated. (G) After Ishikawa cells were treated with 20 µM MG132 for 8 h, the levels of ubiquitination in the cells were measured by co-IP . ****, p < 0.0001. Data are presented as mean ± SD Page 11 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647 SOX18 overexpression worsened the progression of EMS in an animal model Our in vitro experiments demonstrated that SOX18 fos - tered the proliferation, migration, invasion and EMT. We next asked whether SOX18 affects the develop - ment of EMS in vivo. To test this hypothesis, we estab - lished allograft mouse model of EMS. In the therapeutic model, endometriotic-like lesions were observed. The

suggested that the EMS mice had obvious endo - metriotic-like lesions, and the lesions were more severe after SOX18 overexpression (Fig.  8A). Meanwhile, H&E staining revealed successful formation of cystic endome - triotic lesions with epithelial and stromal cells in EMS mice overexpressing SOX18 (Fig.  8B). Overexpression of SOX18 increased the levels of Vimentin in the ectopic endometrial tissues of recipient mice (Fig.  8C). Further- more, the expression of SOX18, and YAP1 and OTUB1 in the ectopic endometrial tissues of recipient mice was also upregulated in response to SOX18 overexpression (Fig.  8D-E). Following on these results, we emphasized that SOX18 overexpression worsened the progression of EMS in vivo.

EMS is one of the most common causes of chronic pelvic pain and infertility [ 23]. EMT is a special biological pro - cess in which immotile epithelial cells are transformed into highly motile mesenchymal cells with migratory and invasive properties during EMS [ 24, 25]. This study investigated the effect of SOX18 on the EMS develop - ment and the possible underlying molecular mechanism in Ishikawa cells and a surgically induced mouse EMS model. SOX18, a member of the SOX transcription factor family, is involved in a variety of biological processes. Increasing evidence suggested that SOX18 promoted the progression of many cancers. For example, SOX18 exacerbated gastric cancer metastasis via transactivat - ing MCAM and CCL7 [ 9]. Overexpression of SOX18 also promoted cell metastasis in hepatocellular carci - noma [ 26]. Downregulation of SOX18 suppressed the proliferation, migration and invasion of laryngeal can - cer cells via regulation of JAK2/STAT3 signaling path - way [ 27]. Upregulation of SOX18 in colorectal cancer cells also significantly elicited proliferation and inhib - ited apoptosis [ 28]. In this work, bioinformatics analysis showed a significant increase in SOX18 expression in ectopic endometrial tissues compared to ectopic endo - metrial tissues. The above results were also confirmed by IHC staining of clinical samples. Ishikawa, a human endometrial adenocarcinoma cell line, is usually selected as a cell model to study the transformation of endome - trial glandular epithelial cells from non-receptive state to receptive state [ 29]. In the present study, cell func - tion experiments suggested that SOX18 overexpression played an important role in maintaining proliferation, migration and invasion of Ishikawa cells, whereas down - regulation of SOX18 inhibited these cellular bioactivi - ties. Concomitantly, upregulation of SOX18 increased the expression of N-cadherin and vimentin, as well as decreased the expression of E-cadherin, indicating that SOX18 enhanced EMT procession. Therefore, SOX18 Fig. 7 OTUB1 knockdown abolished the effect of SOX18 overexpression on Ishikawa cells. ( A) Cell viability was tested by CCK8 assay. ( B) Cell invasion was detected by Transwell assay. Scale bar: 100 μm. (C) The expression of E-cadherin, N-cadherin and Vimentin was determined by western blot. (D) The expression of YAP1 in the cells was measured by western blot. **, p < 0.01. ****, p < 0.0001. Data are presented as mean ± SD Page 12 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647 may exhibit oncogene-like properties in EMS by trigger - ing the EMT process. In allograft mouse model of EMS, our results ascertained that SOX18 overexpression led to the worsening of EMS, manifested by increased lesions and histological changes in mice. These data substan - tiated that SOX18 participated in the development of EMS. Nevertheless, further investigation is warranted to elucidate the underlying molecular mechanism. YAP1 is a downstream effector of Hippo pathway. When activated, YAP1 localizes to the nucleus and binds to transcription factors such as TEA domain DNA bind - ing family of transcription factors (TEAD) [ 30]. Next, YAP1 instigates tumor growth, metastasis of cancer cells and induces EMT in a variety of tumors. For example, YAP1 regulated the transcription of Slug by interacting with TEAD to induce EMT in non-small cell lung can - cer [ 31]. In addition, elevated YAP1 expression facili - tated proliferation and blocked apoptosis in endometrial stromal cells [ 16]. Herein, we further explored whether SOX18 plays a role in EMS by regulating Hippo/YAP1 signaling pathway. As demonstrated, SOX18 upregulated the levels of YAP1 and its downstream factor CTGF, sug- gesting that SOX18 enhanced the Hippo/YAP1 signaling pathway. Functional rescue experiments corroborated that YAP1 knockdown eliminated the influence of SOX18 on EMS progression, indicating that SOX18 promoted EMS progression through regulating the Hippo/YAP1 signaling pathway. Fig. 8 SOX18 overexpression worsened the progression of EMS in an animal model. (A) Photographs of endometriotic lesions in recipient mice. (B) H&E staining was used to detect the histopathological changes of ectopic endometrium in recipient mice. Scale bar: 100 μm. ( C) The expression of Vimentin in ectopic endometrial tissues of recipient mice was measured by IHC staining. (D) Real-time PCR or western blot were used to examine the expression of SOX18 and YAP1 in ectopic endometrial tissues of recipient mice. Scale bar: 50 μm. (E) The expression of OTUB1 in ectopic endometrial tissues of recipient mice was tested by real-time PCR and IHC staining. Scale bar: 50 μm. *, p < 0.05. ****, p < 0.0001. Data are presented as mean ± SD Page 13 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647 In order to further explore the potential mechanism of SOX18 and Hippo/YAP1 signaling pathway, we analyzed the potential downstream factors of SOX18. Analysis of Jaspar database revealed that the binding sites of SOX18 existed in the promoter region of OTUB1, suggesting that OTUB1 may be regulated by SOX18. OTUB1 is a deubiquitinating enzyme that blocks ubiquitination. A previous study unraveled that OTUB1 contributed to the pathogenesis of EMS by stabilizing HSF1 [ 20]. Our series of experiments verified that SOX18 bound to the OTUB1 promoter region and promoted its transcription. Based on these results, we postulated that SOX18 instigated the development of EMS through transcriptional activation of OTUB1. Of note, OTUB1 led to gastric cancer progression by stabilizing YAP1 and regulating Hippo/YAP1 signaling [21]. Accordingly, we also identified the regulatory rela - tionship between OTUB1 and YAP1. Co-IP verified the combination of OTUB1 and YAP1. Additionally, our data confirmed that OTUB1 deubiquitinated YAP1 and pro - moted its protein stabilization. We further emphasized whether OTUB1 mediates the impact of SOX18 on EMS progression and the Hippo/YAP1 signaling pathway. Rescue experiment results demonstrated that knocking down OTUB1 abrogated the effect of SOX18 overex - pression, suggesting that the SOX18-OTUB1-YAP1 axis played a vital role during EMS. However, there are some limitations to this study. First, the results of this study are expected to provide a new theoretical basis and a new target for the early detec - tion, diagnosis, and clinical treatment of EMS. However, further validation of additional EMS patient samples is needed to confirm the clinical value of SOX18. In addition, we performed functional experiments using Ishikawa cells instead of primary endometrial epithelial cells, which may lead to unreliable conclusions. Finally, EMS may involve other pathogenic mechanisms. For example, SOX18 may also affect the progression of EMS by regulating NF-kappa B signaling pathway and PI3K- Akt signaling pathway. Thus, the deeper mechanism of SOX18 also need to be further studied.

According to these findings, our study provides in vitro and in vivo evidence to shed light on the role of SOX18 in EMS and reveal its potential molecular mechanism (Fig. 9). Targeting the SOX18-OTUB1-YAP1 axis may be a promising treatment strategy for EMS. Fig. 9 Schematic illustration showing the mechanism of SOX18-OTUB1-YAP1 axis in promoting EMS progression Page 14 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647 Supplementary Information The online version contains supplementary material available at h t t p s : / / d o i . o r g / 1 0 . 1 1 8 6 / s 1 2 9 6 7 - 0 2 5 - 0 6 6 7 7 - y. Supplementary Material 1

We thank the staff of Second Affiliated Hospital of Nanchang University for their efforts in clinical sample collection. Author contributions Ying Feng did experiments, wrote and revised the manuscript. Jiamei Yue, Si Fan and Jiayan Wu collected data, performed data analysis and summarized the results. All authors reviewed and approved the final version of the manuscript. Funding This work was supported by the Natural Science Foundation of Jiangxi Province (Grant No. 20232BAB206027). Data availability All data generated or analyzed during this study are available from the corresponding author upon reasonable request. Declarations Ethics approval The clinical study was approved by the Medical Ethics Committee of the Second Affiliated Hospital of Nanchang University and conducted in accordance with the Declaration of Helsinki. The animal experiments were in lined with Guide for the Care and Use of Laboratory Animals, and approved by Ethics Committee of the Nanchang University. Consent for publication All authors approved the final manuscript and the submission to this journal. Competing interests The authors state that there are no conflicts of interest. Received: 11 April 2025 / Accepted: 30 May 2025

1. Zondervan KT, Becker CM, Koga K, Missmer SA, Taylor RN. Vigano P: endome- triosis. Nat Rev Dis Primers. 2018;4:9. 2. Malvezzi H, Marengo EB, Podgaec S, Piccinato CA. Endometriosis: current challenges in modeling a multifactorial disease of unknown etiology. J Transl Med. 2020;18:311. 3. Gruber TM, Mechsner S. Pathogenesis of endometriosis: the origin of pain and subfertility. Cells. 2021;10. 4. Matias-Guiu X, Stewart CJR. Endometriosis-associated ovarian neoplasia. Pathology. 2018;50:190–204. 5. Falcone T, Flyckt R. Clinical management of endometriosis. Obstet Gynecol. 2018;131:557–71. 6. Grimm D, Bauer J, Wise P , Kruger M, Simonsen U, Wehland M, Infanger M, Corydon TJ. The role of SOX family members in solid tumours and metastasis. Semin Cancer Biol. 2020;67:122–53. 7. Chen J, Feng W, Sun M, Huang W, Wang G, Chen X, Yin Y, Chen X, Zhang B, Nie Y, et al. TGF-beta1-Induced SOX18 elevation promotes hepatocellular carcinoma progression and metastasis through transcriptionally upregulating PD-L1 and CXCL12. Gastroenterology. 2024;167:264–80. 8. Huaqi Y, Caipeng Q, Qiang W, Yiqing D, Tao X. The role of SOX18 in bladder cancer and its underlying mechanism in mediating cellular functions. Life Sci. 2019;232:116614. 9. Chen J, Dang Y, Feng W, Qiao C, Liu D, Zhang T, Wang Y, Tian D, Fan D, Nie Y, et al. SOX18 promotes gastric cancer metastasis through transactivating MCAM and CCL7. Oncogene. 2020;39:5536–52. 10. Huaqi Y, Caipeng Q, Qiang W, Yiqing D, Xiang D, Xu T, Xiaowei Z, Qing L, Shijun L, Tao X. Transcription factor SOX18 promotes clear cell renal cell car- cinoma progression and alleviates Cabozantinib-Mediated inhibitory effects. Mol Cancer Ther. 2019;18:2433–45. 11. Yin H, Sheng Z, Zhang X, Du Y, Qin C, Liu H, Dun Y, Wang Q, Jin C, Zhao Y, Xu T. Overexpression of SOX18 promotes prostate cancer progression via the regu- lation of TCF1, c-Myc, Cyclin D1 and MMP-7. Oncol Rep. 2017;37:1045–51. 12. Jiang T, Li Z, Zhao D, Hui B, Zheng Z. SOX18 enhances the proliferation and migration of airway smooth muscle cells induced by tumor necrosis factor-alpha via the regulation of Notch1 signaling. Int Immunopharmacol. 2021;96:107746. 13. Zhao B, Tumaneng K, Guan KL. The Hippo pathway in organ size control, tissue regeneration and stem cell self-renewal. Nat Cell Biol. 2011;13:877–83. 14. Zhao W, Wang M, Cai M, Zhang C, Qiu Y, Wang X, Zhang T, Zhou H, Wang J, Zhao W, Shao R. Transcriptional co-activators YAP/TAZ: potential therapeutic targets for metastatic breast cancer. Biomed Pharmacother. 2021;133:110956. 15. Mui CW, Chan WN, Chen B, Cheung AH, Yu J, Lo KW, Ke H, Kang W, To KF. Targeting YAP1/TAZ in nonsmall-cell lung carcinoma: from molecular mecha- nisms to precision medicine. Int J Cancer. 2023;152:558–71. 16. Song Y, Fu J, Zhou M, Xiao L, Feng X, Chen H, Huang W. Activated Hippo/Yes- Associated protein pathway promotes cell proliferation and Anti-apoptosis in endometrial stromal cells of endometriosis. J Clin Endocrinol Metab. 2016;101:1552–61. 17. Herhaus L, Al-Salihi M, Macartney T, Weidlich S, Sapkota GP . OTUB1 enhances TGFbeta signalling by inhibiting the ubiquitylation and degradation of active SMAD2/3. Nat Commun. 2013;4:2519. 18. Zhu D, Xu R, Huang X, Tang Z, Tian Y, Zhang J, Zheng X. Deubiquitinating enzyme OTUB1 promotes cancer cell immunosuppression via preventing ER-associated degradation of immune checkpoint protein PD-L1. Cell Death Differ. 2021;28:1773–89. 19. Han X, Ren C, Lu C, Qiao P , Yang T, Yu Z. Deubiquitination of MYC by OTUB1 contributes to HK2 mediated Glycolysis and breast tumorigenesis. Cell Death Differ. 2022;29:1864–73. 20. Ling X, Lu J, Wang X, Liu L, Liu L, Wang Y, Sun Y, Ren C, Lu C, Yu Z. Ovar- ian tumorB1-mediated heat shock transcription factor 1 deubiquitina- tion is critical for Glycolysis and development of endometriosis. iScience. 2022;25:105363. 21. Yan C, Yang H, Su P , Li X, Li Z, Wang D, Zang Y, Wang T, Liu Z, Bao Z, et al. OTUB1 suppresses Hippo signaling via modulating YAP protein in gastric cancer. Oncogene. 2022;41:5186–98. 22. Zhang Z, Wang J, Chen Y, Suo L, Chen H, Zhu L, Wan G, Han X. Activin a pro- motes myofibroblast differentiation of endometrial mesenchymal stem cells via STAT3-dependent smad/ctgf pathway. Cell Commun Signal. 2019;17:45. 23. Giudice LC. Clinical practice. Endometriosis. N Engl J Med. 2010;362:2389–98. 24. Xiong W, Zhang L, Liu H, Li N, Du Y, He H, Zhang Z, Liu Y. E(2) -mediated EMT by activation of beta-catenin/Snail signalling during the development of ovarian endometriosis. J Cell Mol Med. 2019;23:8035–45. 25. Ruan J, Tian Q, Li S, Zhou X, Sun Q, Wang Y, Xiao Y, Li M, Chang K, Yi X. The IL-33-ST2 axis plays a vital role in endometriosis via promoting epithelial-mes- enchymal transition by phosphorylating beta-catenin. Cell Commun Signal. 2024;22:318. 26. Chen J, Du F, Dang Y, Li X, Qian M, Feng W, Qiao C, Fan D, Nie Y, Wu K, Xia L. Fibroblast growth factor 19-Mediated Up-regulation of SYR-Related High- Mobility group box 18 promotes hepatocellular carcinoma metastasis by transactivating fibroblast growth factor receptor 4 and Fms-Related tyrosine kinase 4. Hepatology. 2020;71:1712–31. 27. Xu Y, Zhang Q, Zhou J, Li Z, Guo J, Wang W, Wang W. Down-regulation of SOX18 inhibits laryngeal carcinoma cell proliferation, migration, and invasion through JAK2/STAT3 signaling. Biosci Rep. 2019;39. 28. Miao Z, Deng X, Shuai P , Zeng J. Upregulation of SOX18 in colorectal cancer cells promotes proliferation and correlates with colorectal cancer risk. Onco Targets Ther. 2018;11:8481–90. 29. Huang Y, Wang Z, Li B, Ke L, Xiong Y, Zhang Y. Loss of KLF15 impairs endome- trial receptivity by inhibiting EMT in endometriosis. J Endocrinol. 2024;261. 30. Akrida I, Makrygianni M, Nikou S, Mulita F, Bravou V, Papadaki H. Hippo path- way effectors YAP , TAZ and TEAD are associated with EMT master regulators ZEB, snail and with aggressive phenotype in phyllodes breast tumors. Pathol Res Pract. 2024;262:155551. Page 15 of 15 Feng et al. Journal of Translational Medicine (2025) 23:647 31. Yu M, Chen Y, Li X, Yang R, Zhang L, Huangfu L, Zheng N, Zhao X, Lv L, Hong Y, et al. YAP1 contributes to NSCLC invasion and migration by promoting slug transcription via the transcription co-factor TEAD. Cell Death Dis. 2018;9:464. Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.